Abca1 | GeneID:313210 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 313210 Official Symbol Abca1
Locus N/A Gene Type protein-coding
Synonyms
Full Name ATP-binding cassette, sub-family A (ABC1), member 1
Description ATP-binding cassette, sub-family A (ABC1), member 1
Chromosome 5q24
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 21130

ID Symbol Protein Species
GeneID:19 ABCA1 NP_005493.2 Homo sapiens
GeneID:11303 Abca1 NP_038482.3 Mus musculus
GeneID:313210 Abca1 NP_835196.1 Rattus norvegicus
GeneID:373945 ABCA1 NP_989476.1 Gallus gallus
GeneID:464630 ABCA1 XP_001138040.1 Pan troglodytes
GeneID:481651 ABCA1 XP_538773.2 Canis lupus familiaris
GeneID:535379 ABCA1 NP_001019864.1 Bos taurus
GeneID:558924 abca1a XP_687304.3 Danio rerio
GeneID:818768 AT2G41700 NP_850354.2 Arabidopsis thaliana

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab66217 ABCA1 antibody [HJ1] (ab66217); Mouse monoclonal [HJ1] to ABCA1
2 abcam ab14146 ABCA1 antibody (ab14146); Rabbit polyclonal to ABCA1

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005794 Component Golgi apparatus
GO:0005887 Component integral to plasma membrane
GO:0043231 Component intracellular membrane-bounded organelle
GO:0005624 Component membrane fraction
GO:0045121 Component membrane raft
GO:0045335 Component phagocytic vesicle
GO:0005886 Component plasma membrane
GO:0008509 Function anion transmembrane transporter activity
GO:0034188 Function apolipoprotein A-I receptor activity
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0017127 Function cholesterol transporter activity
GO:0008035 Function high-density lipoprotein binding
GO:0000166 Function nucleotide binding
GO:0005548 Function phospholipid transporter activity
GO:0005515 Function protein binding
GO:0031267 Function small GTPase binding
GO:0030349 Function syntaxin-13 binding
GO:0032488 Process Cdc42 protein signal transduction
GO:0033344 Process cholesterol efflux
GO:0042632 Process cholesterol homeostasis
GO:0008203 Process cholesterol metabolic process
GO:0030301 Process cholesterol transport
GO:0016197 Process endosome transport
GO:0007186 Process G-protein coupled receptor protein signaling pathway
GO:0034380 Process high-density lipoprotein particle assembly
GO:0050702 Process interleukin-1 beta secretion
GO:0032367 Process intracellular cholesterol transport
GO:0042158 Process lipoprotein biosynthetic process
GO:0042157 Process lipoprotein metabolic process
GO:0007040 Process lysosome organization
GO:0002790 Process peptide secretion
GO:0006911 Process phagocytosis, engulfment
GO:0033700 Process phospholipid efflux
GO:0055091 Process phospholipid homeostasis
GO:0045332 Process phospholipid translocation
GO:0015914 Process phospholipid transport
GO:0060155 Process platelet dense granule organization
GO:0030819 Process positive regulation of cAMP biosynthetic process
GO:0006497 Process protein amino acid lipidation
GO:0042493 Process response to drug
GO:0007584 Process response to nutrient
GO:0043691 Process reverse cholesterol transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_178095  UCSC Browser NP_835196

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000024564 MI0003131 hsa-miR-492 AGGACCUGCGGGACAAGAUUCUU
ENSRNOT00000024564 MI0003193 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
ENSRNOT00000024564 MI0003170 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENSRNOT00000024564 MI0003173 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENSRNOT00000024564 MI0003178 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENSRNOT00000024564 MI0003182 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENSRNOT00000024564 MI0003164 hsa-miR-520d-5p CUACAAAGGGAAGCCCUUUC
ENSRNOT00000024564 MI0003146 hsa-miR-520f AAGUGCUUCCUUUUAGAGGGUU
ENSRNOT00000024564 MI0003160 hsa-miR-524-3p GAAGGCGCUUCCCUUUGGAGU
ENSRNOT00000024564 MI0003160 hsa-miR-524-5p CUACAAAGGGAAGCACUUUCUC
ENSRNOT00000024564 MI0003152 hsa-miR-525-3p GAAGGCGCUUCCCUUUAGAGCG
ENSRNOT00000024564 MI0003579 hsa-miR-572 GUCCGCUCGGCGGUGGCCCA
ENSRNOT00000024564 MI0003609 hsa-miR-597 UGUGUCACUCGAUGACCACUGU
ENSRNOT00000024564 MI0003642 hsa-miR-628-3p UCUAGUAAGAGUGGCAGUCGA
ENSRNOT00000024564 MI0003656 hsa-miR-641 AAAGACAUAGGAUAGAGUCACCUC
ENSRNOT00000024564 MI0005560 hsa-miR-885-5p UCCAUUACACUACCCUGCCUCU
ENSRNOT00000024564 MI0005714 hsa-miR-922 GCAGCAGAGAAUAGGACUACGUC
ENSRNOT00000024564 MI0004644 mmu-miR-682 CUGCAGUCACAGUGAAGUCUG
ENSRNOT00000024564 MI0004684 mmu-miR-700 CACGCGGGAACCGAGUCCACC
ENSRNOT00000024564 MI0000925 rno-miR-181a AACAUUCAACGCUGUCGGUGAGU
ENSRNOT00000024564 MI0000953 rno-miR-181a AACAUUCAACGCUGUCGGUGAGU
ENSRNOT00000024564 MI0000926 rno-miR-181b AACAUUCAUUGCUGUCGGUGGGU
ENSRNOT00000024564 MI0000927 rno-miR-181b AACAUUCAUUGCUGUCGGUGGGU
ENSRNOT00000024564 MI0006132 rno-miR-181d AACAUUCAUUGUUGUCGGUGGGU
ENSRNOT00000024564 MI0006133 rno-miR-182 UUUGGCAAUGGUAGAACUCACACCG
ENSRNOT00000024564 MI0000928 rno-miR-183 UAUGGCACUGGUAGAAUUCACU
ENSRNOT00000024564 MI0000850 rno-miR-21 UAGCUUAUCAGACUGAUGUUGA
ENSRNOT00000024564 MI0003483 rno-miR-224 CAAGUCACUAGUGGUUCCGUUUA
ENSRNOT00000024564 MI0000965 rno-miR-291a-3p AAAGUGCUUCCACUUUGUGUGCC
ENSRNOT00000024564 MI0000594 rno-miR-324-3p CCACUGCCCCAGGUGCUGCUGG
ENSRNOT00000024564 MI0000874 rno-miR-33 GUGCAUUGUAGUUGCAUUGCA
ENSRNOT00000024564 MI0003487 rno-miR-377 AUCACACAAAGGCAACUUUUGG
ENSRNOT00000024564 MI0003546 rno-miR-381 UAUACAAGGGCAAGCUCUC
ENSRNOT00000024564 MI0006152 rno-miR-495 AAACAAACAUGGUGCACUUCUU
ENSRNOT00000024564 MI0006154 rno-miR-532-5p CAUGCCUUGAGUGUAGGACUGU
ENSRNOT00000024564 MI0000881 rno-miR-96 UUUGGCACUAGCACAUUUUUGCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Lee TS, et al. (2009) "Resistin increases lipid accumulation by affecting class A scavenger receptor, CD36 and ATP-binding cassette transporter-A1 in macrophages." Life Sci. 84(3-4):97-104. PMID:19041881
  2. [ + ] Lin YC, et al. (2009) "ABCA1 modulates the oligomerization and Golgi exit of caveolin-1 during HDL-mediated cholesterol efflux in aortic endothelial cells." Biochem Biophys Res Commun. 382(1):189-195. PMID:19275878
  3. [ + ] Bates SR, et al. (2008) "Expression and biological activity of ABCA1 in alveolar epithelial cells." Am J Respir Cell Mol Biol. 38(3):283-292. PMID:17884990
  4. [ + ] Ghanbari-Niaki A, et al. (2007) "Treadmill exercise enhances ABCA1 expression in rat liver." Biochem Biophys Res Commun. 361(4):841-846. PMID:17689492
  5. [ + ] Sporstol M, et al. (2007) "ABCA1, ABCG1 and SR-BI: hormonal regulation in primary rat hepatocytes and human cell lines." BMC Mol Biol. 8():5. PMID:17241464
  6. [ + ] Tamehiro N, et al. (2007) "Sterol regulatory element-binding protein-2- and liver X receptor-driven dual promoter regulation of hepatic ABC transporter A1 gene expression: mechanism underlying the unique response to cellular cholesterol status." J Biol Chem. 282(29):21090-21099. PMID:17526932
  7. [ + ] Guo L, et al. (2006) "Anti-hyperlipidemic properties of CM108 (a flavone derivative) in vitro and in vivo." Eur J Pharmacol. 551(1-3):80-86. PMID:17026988
  8. [ + ] Hirayama T, et al. (2006) "Hypercholesterolemia in rats with hepatomas: increased oxysterols accelerate efflux but do not inhibit biosynthesis of cholesterol." Hepatology. 44(3):602-611. PMID:16941710
  9. [ + ] Tovar AR, et al. (2005) "Soy protein reduces hepatic lipotoxicity in hyperinsulinemic obese Zucker fa/fa rats." J Lipid Res. 46(9):1823-1832. PMID:15995177
  10. [ + ] Hoekstra M, et al. (2005) "Diet induced regulation of genes involved in cholesterol metabolism in rat liver parenchymal and Kupffer cells." J Hepatol. 42(3):400-407. PMID:15710224
  11. [ + ] Chao WT, et al. (2005) "Cellular localization and interaction of ABCA1 and caveolin-1 in aortic endothelial cells after HDL incubation." Biochem Biophys Res Commun. 332(3):743-749. PMID:15907796
  12. [ + ] Wein S, et al. (2004) "Mediation of annexin 1 secretion by a probenecid-sensitive ABC-transporter in rat inflamed mucosa." Biochem Pharmacol. 67(6):1195-1202. PMID:15006554
  13. [ + ] Sahoo D, et al. (2004) "ABCA1-dependent lipid efflux to apolipoprotein A-I mediates HDL particle formation and decreases VLDL secretion from murine hepatocytes." J Lipid Res. 45(6):1122-1131. PMID:14993246
  14. [ + ] Johnson AC, et al. (2003) "Experimental glomerulopathy alters renal cortical cholesterol, SR-B1, ABCA1, and HMG CoA reductase expression." Am J Pathol. 162(1):283-291. PMID:12507911
  15. [ + ] Guan JZ, et al. (2003) "Clofibrate, a peroxisome-proliferator, enhances reverse cholesterol transport through cytochrome P450 activation and oxysterol generation." Tohoku J Exp Med. 201(4):251-259. PMID:14690017
  16. [ + ] Bortnick AE, et al. (2003) "Identification and characterization of rodent ABCA1 in isolated type II pneumocytes." Am J Physiol Lung Cell Mol Physiol. 285(4):L869-L878. PMID:12909583
  17. [ + ] Wu Q, et al. (2003) "Lipoprotein enhancement of ovarian theca-interstitial cell steroidogenesis: relative contribution of scavenger receptor class B (type I) and adenosine 5'-triphosphate- binding cassette (type A1) transporter in high-density lipoprotein-cholesterol transport and androgen synthesis." Endocrinology. 144(6):2437-2445. PMID:12746305