Abcg2 | GeneID:312382 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 312382 Official Symbol Abcg2
Locus N/A Gene Type protein-coding
Synonyms BCRP1
Full Name ATP-binding cassette, sub-family G (WHITE), member 2
Description ATP-binding cassette, sub-family G (WHITE), member 2
Chromosome 4q24
Also Known As ATP-binding cassette protein G2
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 55852

ID Symbol Protein Species
GeneID:9429 ABCG2 NP_004818.2 Homo sapiens
GeneID:26357 Abcg2 NP_036050.1 Mus musculus
GeneID:312382 Abcg2 NP_852046.1 Rattus norvegicus
GeneID:423767 ABCG2 XP_421638.2 Gallus gallus
GeneID:471251 ABCG2 XP_526633.2 Pan troglodytes
GeneID:478472 ABCG2 XP_535650.2 Canis lupus familiaris
GeneID:536203 ABCG2 NP_001032555.2 Bos taurus
GeneID:735310 abcg2d NP_001036237.1 Danio rerio
GeneID:811826 PF14_0244 XP_001348418.1 Plasmodium falciparum
GeneID:830541 AT5G06530 NP_850781.2 Arabidopsis thaliana
GeneID:850369 ADP1 NP_009937.2 Saccharomyces cerevisiae
GeneID:2679509 MGG_01563 XP_363637.2 Magnaporthe grisea
GeneID:2713604 NCU02544.1 XP_331743.1 Neurospora crassa
GeneID:2892892 KLLA0D04554g XP_453265.1 Kluyveromyces lactis
GeneID:4331674 Os03g0157400 NP_001049014.1 Oryza sativa
GeneID:4621257 AGOS_AER190W NP_985047.1 Eremothecium gossypii

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0005886 Component plasma membrane
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0015238 Function drug transporter activity
GO:0000166 Function nucleotide binding
GO:0005515 Function protein binding
GO:0046983 Function protein dimerization activity
GO:0042803 Function protein homodimerization activity
GO:0015893 Process drug transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_181381  UCSC Browser NP_852046

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000009546 MI0000781 hsa-miR-373 GAAGUGCUUCGAUUUUGGGGUGU
ENSRNOT00000009546 MI0003156 hsa-miR-518b CAAAGCGCUCCCCUUUAGAGGU
ENSRNOT00000009546 MI0003159 hsa-miR-518c CAAAGCGCUUCUCUUUAGAGUGU
ENSRNOT00000009546 MI0003154 hsa-miR-518f GAAAGCGCUUCUCUUUAGAGG
ENSRNOT00000009546 MI0003162 hsa-miR-519d CAAAGUGCCUCCCUUUAGAGUG
ENSRNOT00000009546 MI0003145 hsa-miR-519e AAGUGCCUCCUUUUAGAGUGUU
ENSRNOT00000009546 MI0003149 hsa-miR-520a-3p AAAGUGCUUCCCUUUGGACUGU
ENSRNOT00000009546 MI0003155 hsa-miR-520b AAAGUGCUUCCUUUUAGAGGG
ENSRNOT00000009546 MI0003158 hsa-miR-520c-3p AAAGUGCUUCCUUUUAGAGGGU
ENSRNOT00000009546 MI0003164 hsa-miR-520d-3p AAAGUGCUUCUCUUUGGUGGGU
ENSRNOT00000009546 MI0003143 hsa-miR-520e AAAGUGCUUCCUUUUUGAGGG
ENSRNOT00000009546 MI0003166 hsa-miR-520g ACAAAGUGCUUCCCUUUAGAGUGU
ENSRNOT00000009546 MI0003175 hsa-miR-520h ACAAAGUGCUUCCCUUUAGAGU
ENSRNOT00000009546 MI0003562 hsa-miR-556-3p AUAUUACCAUUAGCUCAUCUUU
ENSRNOT00000009546 MI0003568 hsa-miR-562 AAAGUAGCUGUACCAUUUGC
ENSRNOT00000009546 MI0003594 hsa-miR-586 UAUGCAUUGUAUUUUUAGGUCC
ENSRNOT00000009546 MI0003609 hsa-miR-597 UGUGUCACUCGAUGACCACUGU
ENSRNOT00000009546 MI0003620 hsa-miR-607 GUUCAAAUCCAGAUCUAUAAC
ENSRNOT00000009546 MI0003677 hsa-miR-655 AUAAUACAUGGUUAACCUCUUU
ENSRNOT00000009546 MI0003763 hsa-miR-767-3p UCUGCUCAUACCCCAUGGUUUCU
ENSRNOT00000009546 MI0003763 hsa-miR-767-5p UGCACCAUGGUUGUCUGAGCAUG
ENSRNOT00000009546 MI0000392 mmu-miR-294 AAAGUGCUUCCCUUUUGUGUGU
ENSRNOT00000009546 MI0003716 mmu-miR-302b UAAGUGCUUCCAUGUUUUAGUAG
ENSRNOT00000009546 MI0003718 mmu-miR-302d UAAGUGCUUCCAUGUUUGAGUGU
ENSRNOT00000009546 MI0002402 mmu-miR-467a UAAGUGCCUGCAUGUAUAUGCG
ENSRNOT00000009546 MI0004671 mmu-miR-467b GUAAGUGCCUGCAUGUAUAUG
ENSRNOT00000009546 MI0006128 mmu-miR-467e AUAAGUGUGAGCAUGUAUAUGU
ENSRNOT00000009546 MI0004134 mmu-miR-668 UGUCACUCGGCUCGGCCCACUACC
ENSRNOT00000009546 MI0004662 mmu-miR-693-3p GCAGCUUUCAGAUGUGGCUGUAA
ENSRNOT00000009546 MI0004306 mmu-miR-761 GCAGCAGGGUGAAACUGACACA
ENSRNOT00000009546 MI0005480 mmu-miR-876-5p UGGAUUUCUCUGUGAAUCACUA
ENSRNOT00000009546 MI0000889 rno-miR-106b UAAAGUGCUGACAGUGCAGAU
ENSRNOT00000009546 MI0000891 rno-miR-122 UGGAGUGUGACAAUGGUGUUUG
ENSRNOT00000009546 MI0000914 rno-miR-141 UAACACUGUCUGGUAAAGAUGG
ENSRNOT00000009546 MI0000916 rno-miR-143 UGAGAUGAAGCACUGUAGCUCA
ENSRNOT00000009546 MI0000843 rno-miR-15b UAGCAGCACAUCAUGGUUUACA
ENSRNOT00000009546 MI0006131 rno-miR-17 CAAAGUGCUUACAGUGCAGGUAG
ENSRNOT00000009546 MI0000941 rno-miR-199a-5p CCCAGUGUUCAGACUACCUGUUC
ENSRNOT00000009546 MI0000943 rno-miR-200a UAACACUGUCUGGUAACGAUGU
ENSRNOT00000009546 MI0000638 rno-miR-20a UAAAGUGCUUAUAGUGCAGGUAG
ENSRNOT00000009546 MI0003554 rno-miR-20b-5p CAAAGUGCUCAUAGUGCAGGU
ENSRNOT00000009546 MI0000850 rno-miR-21* CAACAGCAGUCGAUGGGCUGUC
ENSRNOT00000009546 MI0000954 rno-miR-214 ACAGCAGGCACAGACAGGCAG
ENSRNOT00000009546 MI0000955 rno-miR-216a UAAUCUCAGCUGGCAACUGUGA
ENSRNOT00000009546 MI0000857 rno-miR-26a UUCAAGUAAUCCAGGAUAGGCU
ENSRNOT00000009546 MI0000965 rno-miR-291a-3p AAAGUGCUUCCACUUUGUGUGCC
ENSRNOT00000009546 MI0000965 rno-miR-291a-5p CAUCAAAGUGGAGGCCCUCUCU
ENSRNOT00000009546 MI0000862 rno-miR-29b-2* CUGGUUUCACAUGGUGGCUUAG
ENSRNOT00000009546 MI0000626 rno-miR-342-5p AGGGGUGCUAUCUGUGAUUGAG
ENSRNOT00000009546 MI0001423 rno-miR-421 GGCCUCAUUAAAUGUUUGUUG
ENSRNOT00000009546 MI0000641 rno-miR-7a* ACAACAAAUCACAGUCUGCCAU
ENSRNOT00000009546 MI0000880 rno-miR-93 CAAAGUGCUGUUCGUGCAGGUAG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Shukla S, et al. (2009) "Curcumin inhibits the activity of ABCG2/BCRP1, a multidrug resistance-linked ABC drug transporter in mice." Pharm Res. 26(2):480-487. PMID:18841445
  2. [ + ] Cygalova L, et al. (2008) "Role of breast cancer resistance protein (Bcrp/Abcg2) in fetal protection during gestation in rat." Toxicol Lett. 178(3):176-180. PMID:18450391
  3. [ + ] MacLean C, et al. (2008) "Closing the gaps: a full scan of the intestinal expression of p-glycoprotein, breast cancer resistance protein, and multidrug resistance-associated protein 2 in male and female rats." Drug Metab Dispos. 36(7):1249-1254. PMID:18378562
  4. [ + ] Lee G, et al. (2007) "Expression of the ATP-binding cassette membrane transporter, ABCG2, in human and rodent brain microvessel endothelial and glial cell culture systems." Pharm Res. 24(7):1262-1274. PMID:17380269
  5. [ + ] Bhattacharya S, et al. (2007) "Maintenance of retinal stem cells by Abcg2 is regulated by notch signaling." J Cell Sci. 120(Pt 15):2652-2662. PMID:17635990
  6. [ + ] Staud F, et al. (2006) "Expression and transport activity of breast cancer resistance protein (Bcrp/Abcg2) in dually perfused rat placenta and HRP-1 cell line." J Pharmacol Exp Ther. 319(1):53-62. PMID:16809480
  7. [ + ] Yasuda S, et al. (2005) "Expression level of ABCG2 in the placenta decreases from the mid stage to the end of gestation." Biosci Biotechnol Biochem. 69(10):1871-1876. PMID:16244436
  8. [ + ] Adachi Y, et al. (2005) "Role of breast cancer resistance protein (Bcrp1/Abcg2) in the extrusion of glucuronide and sulfate conjugates from enterocytes to intestinal lumen." Mol Pharmacol. 67(3):923-928. PMID:15598971
  9. [ + ] Hori S, et al. (2004) "Functional expression of rat ABCG2 on the luminal side of brain capillaries and its enhancement by astrocyte-derived soluble factor(s)." J Neurochem. 90(3):526-536. PMID:15255930
  10. [ + ] Shimano K, et al. (2003) "Hepatic oval cells have the side population phenotype defined by expression of ATP-binding cassette transporter ABCG2/BCRP1." Am J Pathol. 163(1):3-9. PMID:12819005
  11. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932