Abcf2 | GeneID:311959 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 311959 Official Symbol Abcf2
Locus N/A Gene Type protein-coding
Synonyms
Full Name ATP-binding cassette, sub-family F (GCN20), member 2
Description ATP-binding cassette, sub-family F (GCN20), member 2
Chromosome 4q11
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 21408

ID Symbol Protein Species
GeneID:10061 ABCF2 NP_005683.2 Homo sapiens
GeneID:27407 Abcf2 NP_038881.1 Mus musculus
GeneID:32508 CG9281 NP_573057.1 Drosophila melanogaster
GeneID:176771 abcf-2 NP_499779.1 Caenorhabditis elegans
GeneID:311959 Abcf2 XP_231307.1 Rattus norvegicus
GeneID:336770 abcf2 NP_958472.1 Danio rerio
GeneID:426038 ABCF2 NP_001006562.1 Gallus gallus
GeneID:463887 ABCF2 XP_001139777.1 Pan troglodytes
GeneID:482806 ABCF2 XP_850220.1 Canis lupus familiaris
GeneID:513061 ABCF2 NP_001039601.1 Bos taurus
GeneID:836200 ATGCN1 NP_200887.1 Arabidopsis thaliana
GeneID:1273267 AgaP_AGAP002693 XP_312228.2 Anopheles gambiae
GeneID:4346343 Os08g0564100 NP_001062528.1 Oryza sativa
GeneID:4347924 Os09g0572400 NP_001063997.1 Oryza sativa
GeneID:100000576 LOC100000576 XP_001337123.1 Danio rerio

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001109666  UCSC Browser NP_001103136
2 XM_001057136  UCSC Browser XP_001057136
3 XM_231307  UCSC Browser XP_231307

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000014718 MI0004999 gga-miR-757 GCAGAGCUGCAGAUGGGAUUC
ENSRNOT00000014718 MI0005000 gga-miR-757 GCAGAGCUGCAGAUGGGAUUC
ENSRNOT00000014718 MI0000240 hsa-miR-198 GGUCCAGAGGGGAGAUAGGUUC
ENSRNOT00000014718 MI0003144 hsa-miR-515-5p UUCUCCAAAAGAAAGCACUUUCUG
ENSRNOT00000014718 MI0003147 hsa-miR-515-5p UUCUCCAAAAGAAAGCACUUUCUG
ENSRNOT00000014718 MI0003167 hsa-miR-516b AUCUGGAGGUAAGAAGCACUUU
ENSRNOT00000014718 MI0003172 hsa-miR-516b AUCUGGAGGUAAGAAGCACUUU
ENSRNOT00000014718 MI0003160 hsa-miR-524-3p GAAGGCGCUUCCCUUUGGAGU
ENSRNOT00000014718 MI0003152 hsa-miR-525-3p GAAGGCGCUUCCCUUUAGAGCG
ENSRNOT00000014718 MI0003569 hsa-miR-563 AGGUUGACAUACGUUUCCC
ENSRNOT00000014718 MI0003617 hsa-miR-604 AGGCUGCGGAAUUCAGGAC
ENSRNOT00000014718 MI0003634 hsa-miR-620 AUGGAGAUAGAUAUAGAAAU
ENSRNOT00000014718 MI0003645 hsa-miR-631 AGACCUGGCCCAGACCUCAGC
ENSRNOT00000014718 MI0003650 hsa-miR-635 ACUUGGGCACUGAAACAAUGUCC
ENSRNOT00000014718 MI0003655 hsa-miR-640 AUGAUCCAGGAACCUGCCUCU
ENSRNOT00000014718 MI0003659 hsa-miR-644 AGUGUGGCUUUCUUAGAGC
ENSRNOT00000014718 MI0005769 hsa-miR-944 AAAUUAUUGUACAUCGGAUGAG
ENSRNOT00000014718 MI0004694 mmu-miR-710 CCAAGUCUUGGGGAGAGUUGAG
ENSRNOT00000014718 MI0004704 mmu-miR-717 CUCAGACAGAGAUACCUUCUCU
ENSRNOT00000014718 MI0004124 mmu-miR-744 UGCGGGGCUAGGGCUAACAGCA
ENSRNOT00000014718 MI0004516 mmu-miR-763 CCAGCUGGGAAGAACCAGUGGC
ENSRNOT00000014718 MI0000885 rno-miR-100 AACCCGUAGAUCCGAACUUGUG
ENSRNOT00000014718 MI0000887 rno-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENSRNOT00000014718 MI0000888 rno-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENSRNOT00000014718 MI0000890 rno-miR-107 AGCAGCAUUGUACAGGGCUAUCA
ENSRNOT00000014718 MI0000891 rno-miR-122 UGGAGUGUGACAAUGGUGUUUG
ENSRNOT00000014718 MI0000909 rno-miR-136* CAUCAUCGUCUCAAAUGAGUCU
ENSRNOT00000014718 MI0000911 rno-miR-138 AGCUGGUGUUGUGAAUCAGGCCG
ENSRNOT00000014718 MI0000912 rno-miR-138 AGCUGGUGUUGUGAAUCAGGCCG
ENSRNOT00000014718 MI0000928 rno-miR-183 UAUGGCACUGGUAGAAUUCACU
ENSRNOT00000014718 MI0000952 rno-miR-212 UAACAGUCUCCAGUCACGGCCA
ENSRNOT00000014718 MI0000966 rno-miR-292-3p AAGUGCCGCCAGGUUUUGAGUGU
ENSRNOT00000014718 MI0000618 rno-miR-338 UCCAGCAUCAGUGAUUUUGUUGA
ENSRNOT00000014718 MI0000624 rno-miR-341 UCGGUCGAUCGGUCGGUCGGU
ENSRNOT00000014718 MI0003551 rno-miR-369-5p AGAUCGACCGUGUUAUAUUCGC
ENSRNOT00000014718 MI0003719 rno-miR-378* CUCCUGACUCCAGGUCCUGUGU
ENSRNOT00000014718 MI0003550 rno-miR-409-5p AGGUUACCCGAGCAACUUUG
ENSRNOT00000014718 MI0006146 rno-miR-425 AAUGACACGAUCACUCCCGUUGA
ENSRNOT00000014718 MI0006149 rno-miR-463 UGAUAGACGCCAAUUUGGGUAG
ENSRNOT00000014718 MI0003549 rno-miR-485 AGAGGCUGGCCGUGAUGAAUUC
ENSRNOT00000014718 MI0006118 rno-miR-874 CUGCCCUGGCCCGAGGGACCGA
ENSRNOT00000014718 MI0000883 rno-miR-99a AACCCGUAGAUCCGAUCUUGUG
ENSRNOT00000014718 MI0000884 rno-miR-99b CACCCGUAGAACCGACCUUGCG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932