Abl1 | GeneID:311860 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 311860 Official Symbol Abl1
Locus N/A Gene Type protein-coding
Synonyms Abl
Full Name c-abl oncogene 1, receptor tyrosine kinase
Description c-abl oncogene 1, receptor tyrosine kinase
Chromosome 3p12
Also Known As Abelson murine leukemia viral (v-abl) oncogene homolog 1; v-abl Abelson murine leukemia viral oncogene 1; v-abl Abelson murine leukemia viral oncogene homolog 1
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 3783

ID Symbol Protein Species
GeneID:25 ABL1 NP_009297.2 Homo sapiens
GeneID:11350 Abl1 NP_033724.1 Mus musculus
GeneID:311860 Abl1 XP_001067860.1 Rattus norvegicus
GeneID:417181 ABL1 XP_001233812.1 Gallus gallus
GeneID:464802 ABL1 XP_001166213.1 Pan troglodytes
GeneID:491292 ABL1 XP_548413.2 Canis lupus familiaris
GeneID:540876 ABL1 XP_613548.2 Bos taurus
GeneID:100000720 LOC100000720 XP_001337829.1 Danio rerio

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab63530 c Abl antibody (ab63530); Rabbit polyclonal to c Abl
2 abcam ab62189 c Abl (phospho Y245) antibody (ab62189); Rabbit polyclonal to c Abl (phospho Y245)
3 abcam ab61757 c Abl (phospho Y204) antibody (ab61757); Rabbit polyclonal to c Abl (phospho Y204)
4 abcam ab55284 c Abl (phospho Y412) antibody (ab55284); Rabbit polyclonal to c Abl (phospho Y412)
5 abcam ab32080 c Abl antibody [Y421] (ab32080); Rabbit monoclonal [Y421] to c Abl
6 abcam ab10528 c Abl antibody [ABL-148] (ab10528); Mouse monoclonal [ABL-148] to c Abl
7 sigma A5844 Monoclonal Anti-c-Abl antibody produced in mouse ;

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005730 Component nucleolus
GO:0005634 Component nucleus
GO:0005886 Component plasma membrane
GO:0005524 Function ATP binding
GO:0016301 Function kinase activity
GO:0000287 Function magnesium ion binding
GO:0030145 Function manganese ion binding
GO:0004715 Function non-membrane spanning protein tyrosine kinase activity
GO:0000166 Function nucleotide binding
GO:0005515 Function protein binding
GO:0008022 Function protein C-terminus binding
GO:0019904 Function protein domain specific binding
GO:0004672 Function protein kinase activity
GO:0016740 Function transferase activity
GO:0030036 Process actin cytoskeleton organization
GO:0018108 Process peptidyl-tyrosine phosphorylation
GO:0043065 Process positive regulation of apoptosis
GO:0051353 Process positive regulation of oxidoreductase activity
GO:0006468 Process protein amino acid phosphorylation
GO:0051726 Process regulation of cell cycle

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_001067860  UCSC Browser XP_001067860
2 XM_001079831  UCSC Browser XP_001079831
3 XM_231137  UCSC Browser XP_231137

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000012617 MI0003572 hsa-miR-566 GGGCGCCUGUGAUCCCAAC
ENSRNOT00000012617 MI0005560 hsa-miR-885-5p UCCAUUACACUACCCUGCCUCU
ENSRNOT00000012617 MI0003517 mmu-miR-546 AUGGUGGCACGGAGUC
ENSRNOT00000012617 MI0004647 mmu-miR-684 AGUUUUCCCUUCAAGUCAA
ENSRNOT00000012617 MI0004648 mmu-miR-684 AGUUUUCCCUUCAAGUCAA
ENSRNOT00000012617 MI0004681 mmu-miR-697 AACAUCCUGGUCCUGUGGAGA
ENSRNOT00000012617 MI0004707 mmu-miR-718 CUUCCGCCCGGCCGGGUGUCG
ENSRNOT00000012617 MI0004678 mmu-miR-720 AUCUCGCUGGGGCCUCCA
ENSRNOT00000012617 MI0000889 rno-miR-106b* CCGCACUGUGGGUACUUGCUGC
ENSRNOT00000012617 MI0000841 rno-miR-10a-3p CAAAUUCGUAUCUAGGGGAAUA
ENSRNOT00000012617 MI0000846 rno-miR-18a UAAGGUGCAUCUAGUGCAGAUAG
ENSRNOT00000012617 MI0006145 rno-miR-423 AGCUCGGUCUGAGGCCCCUCAGU
ENSRNOT00000012617 MI0006148 rno-miR-455 UAUGUGCCUUUGGACUACAUCG
ENSRNOT00000012617 MI0006154 rno-miR-532-5p CAUGCCUUGAGUGUAGGACUGU
ENSRNOT00000012617 MI0006116 rno-miR-871 UAUUCAGAUUGGUGCCGGUCACA
ENSRNOT00000012617 MI0006122 rno-miR-880 UACUCCAUUCAUUCUGAGUAGA
ENSRNOT00000042495 MI0005560 hsa-miR-885-5p UCCAUUACACUACCCUGCCUCU
ENSRNOT00000042495 MI0000245 mmu-miR-202-5p UUCCUAUGCAUAUACUUCUUU
ENSRNOT00000042495 MI0004707 mmu-miR-718 CUUCCGCCCGGCCGGGUGUCG
ENSRNOT00000042495 MI0000841 rno-miR-10a-3p CAAAUUCGUAUCUAGGGGAAUA
ENSRNOT00000042495 MI0000945 rno-miR-203 GUGAAAUGUUUAGGACCACUAG
ENSRNOT00000042495 MI0006142 rno-miR-384-5p UGUAAACAAUUCCUAGGCAAUGU
ENSRNOT00000042495 MI0006154 rno-miR-532-5p CAUGCCUUGAGUGUAGGACUGU
ENSRNOT00000042495 MI0003525 rno-miR-543 AAGUUGCCCGCGUGUUUUUCGC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Anfinogenova Y, et al. (2007) "Abl silencing inhibits CAS-mediated process and constriction in resistance arteries." Circ Res. 101(4):420-428. PMID:17615370
  2. [ + ] Mitsushima M, et al. (2006) "Abl kinase interacts with and phosphorylates vinexin." FEBS Lett. 580(17):4288-4295. PMID:16831423
  3. [ + ] Ushio-Fukai M, et al. (2005) "cAbl tyrosine kinase mediates reactive oxygen species- and caveolin-dependent AT1 receptor signaling in vascular smooth muscle: role in vascular hypertrophy." Circ Res. 97(8):829-836. PMID:16151024
  4. [ + ] Alvarez AR, et al. (2004) "Activation of the neuronal c-Abl tyrosine kinase by amyloid-beta-peptide and reactive oxygen species." Neurobiol Dis. 17(2):326-336. PMID:15474370
  5. [ + ] Woodring PJ, et al. (2002) "Modulation of the F-actin cytoskeleton by c-Abl tyrosine kinase in cell spreading and neurite extension." J Cell Biol. 156(5):879-892. PMID:11864995
  6. [ + ] Welch PJ, et al. (1995) "Abrogation of retinoblastoma protein function by c-Abl through tyrosine kinase-dependent and -independent mechanisms." Mol Cell Biol. 15(10):5542-5551. PMID:7565706
  7. [ + ] Mihara K, et al. (1988) "Detection of hypermethylation of the c-abl genomic locus in the spleen of juvenile LE rats." Biochem Biophys Res Commun. 154(3):1061-1066. PMID:2841925
  8. [ + ] Takahashi R, et al. (1986) "Secondary activation of c-abl may be related to translocation to the nucleolar organizer region in an in vitro cultured rat leukemia cell line (K3D)." Proc Natl Acad Sci U S A. 83(4):1079-1083. PMID:3456563