Abca4 | GeneID:310836 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 310836 Official Symbol Abca4
Locus N/A Gene Type protein-coding
Synonyms ABCR
Full Name ATP-binding cassette, sub-family A (ABC1), member 4
Description ATP-binding cassette, sub-family A (ABC1), member 4
Chromosome 2q41
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 298

ID Symbol Protein Species
GeneID:24 ABCA4 NP_000341.2 Homo sapiens
GeneID:11304 Abca4 NP_031404.1 Mus musculus
GeneID:171782 abt-2 NP_490949.3 Caenorhabditis elegans
GeneID:281584 ABCA4 NP_776646.1 Bos taurus
GeneID:310836 Abca4 XP_241525.3 Rattus norvegicus
GeneID:424490 ABCA4 XP_422330.2 Gallus gallus
GeneID:444852 ABCA4 NP_001003360.2 Canis lupus familiaris
GeneID:555506 LOC555506 XP_683123.3 Danio rerio
GeneID:745972 ABCA4 XP_001152577.1 Pan troglodytes

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005575 Component cellular_component
GO:0003674 Function molecular_function
GO:0004012 Function phospholipid-translocating ATPase activity
GO:0005548 Function phospholipid transporter activity
GO:0008150 Process biological_process
GO:0006649 Process phospholipid transfer to membrane
GO:0045494 Process photoreceptor cell maintenance
GO:0007601 Process visual perception

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001107721  UCSC Browser NP_001101191
2 XM_001074129  UCSC Browser XP_001074129
3 XM_241525  UCSC Browser XP_241525

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000017878 MI0003197 hsa-miR-510 UACUCAGGAGAGUGGCAAUCAC
ENSRNOT00000017878 MI0003180 hsa-miR-516a-3p UGCUUCCUUUCAGAGGGU
ENSRNOT00000017878 MI0003181 hsa-miR-516a-3p UGCUUCCUUUCAGAGGGU
ENSRNOT00000017878 MI0003178 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENSRNOT00000017878 MI0003182 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENSRNOT00000017878 MI0003151 hsa-miR-519b-3p AAAGUGCAUCCUUUUAGAGGUU
ENSRNOT00000017878 MI0003162 hsa-miR-519d CAAAGUGCCUCCCUUUAGAGUG
ENSRNOT00000017878 MI0003164 hsa-miR-520d-5p CUACAAAGGGAAGCCCUUUC
ENSRNOT00000017878 MI0003166 hsa-miR-520g ACAAAGUGCUUCCCUUUAGAGUGU
ENSRNOT00000017878 MI0003175 hsa-miR-520h ACAAAGUGCUUCCCUUUAGAGU
ENSRNOT00000017878 MI0003612 hsa-miR-548a-5p AAAAGUAAUUGCGAGUUUUACC
ENSRNOT00000017878 MI0003596 hsa-miR-548b-5p AAAAGUAAUUGUGGUUUUGGCC
ENSRNOT00000017878 MI0003630 hsa-miR-548c-5p AAAAGUAAUUGCGGUUUUUGCC
ENSRNOT00000017878 MI0003564 hsa-miR-558 UGAGCUGCUGUACCAAAAU
ENSRNOT00000017878 MI0003579 hsa-miR-572 GUCCGCUCGGCGGUGGCCCA
ENSRNOT00000017878 MI0003595 hsa-miR-587 UUUCCAUAGGUGAUGAGUCAC
ENSRNOT00000017878 MI0003836 hsa-miR-766 ACUCCAGCCCCACAGCCUCAGC
ENSRNOT00000017878 MI0005540 hsa-miR-889 UUAAUAUCGGACAACCAUUGU
ENSRNOT00000017878 MI0005533 hsa-miR-890 UACUUGGAAAGGCAUCAGUUG
ENSRNOT00000017878 MI0005528 hsa-miR-892a CACUGUGUCCUUUCUGCGUAG
ENSRNOT00000017878 MI0005759 hsa-miR-937 AUCCGCGCUCUGACUCUCUGCC
ENSRNOT00000017878 MI0005768 hsa-miR-943 CUGACUGUUGCCGUCCUCCAG
ENSRNOT00000017878 MI0002400 mmu-miR-465a-3p GAUCAGGGCCUUUCUAAGUAGA
ENSRNOT00000017878 MI0002400 mmu-miR-465a-5p UAUUUAGAAUGGCACUGAUGUGA
ENSRNOT00000017878 MI0005498 mmu-miR-465b-5p UAUUUAGAAUGGUGCUGAUCUG
ENSRNOT00000017878 MI0005499 mmu-miR-465b-5p UAUUUAGAAUGGUGCUGAUCUG
ENSRNOT00000017878 MI0005500 mmu-miR-465c-5p UAUUUAGAAUGGCGCUGAUCUG
ENSRNOT00000017878 MI0005501 mmu-miR-465c-5p UAUUUAGAAUGGCGCUGAUCUG
ENSRNOT00000017878 MI0005518 mmu-miR-574-3p CACGCUCAUGCACACACCCACA
ENSRNOT00000017878 MI0004196 mmu-miR-667 UGACACCUGCCACCCAGCCCAAG
ENSRNOT00000017878 MI0004658 mmu-miR-690 AAAGGCUAGGCUCACAACCAAA
ENSRNOT00000017878 MI0004664 mmu-miR-694 CUGAAAAUGUUGCCUGAAG
ENSRNOT00000017878 MI0004700 mmu-miR-715 CUCCGUGCACACCCCCGCGUG
ENSRNOT00000017878 MI0004554 mmu-miR-759 GCAGAGUGCAAACAAUUUUGAC
ENSRNOT00000017878 MI0004249 mmu-miR-802 UCAGUAACAAAGAUUCAUCCUU
ENSRNOT00000017878 MI0005551 mmu-miR-875-3p CCUGAAAAUACUGAGGCUAUG
ENSRNOT00000017878 MI0005551 mmu-miR-875-5p UAUACCUCAGUUUUAUCAGGUG
ENSRNOT00000017878 MI0000885 rno-miR-100 AACCCGUAGAUCCGAACUUGUG
ENSRNOT00000017878 MI0000637 rno-miR-129 CUUUUUGCGGUCUGGGCUUGC
ENSRNOT00000017878 MI0000902 rno-miR-129 CUUUUUGCGGUCUGGGCUUGC
ENSRNOT00000017878 MI0000907 rno-miR-134 UGUGACUGGUUGACCAGAGGGG
ENSRNOT00000017878 MI0000611 rno-miR-140* UACCACAGGGUAGAACCACGG
ENSRNOT00000017878 MI0000918 rno-miR-145 GUCCAGUUUUCCCAGGAAUCCCU
ENSRNOT00000017878 MI0000920 rno-miR-150 UCUCCCAACCCUUGUACCAGUG
ENSRNOT00000017878 MI0000926 rno-miR-181b AACAUUCAUUGCUGUCGGUGGGU
ENSRNOT00000017878 MI0000927 rno-miR-181b AACAUUCAUUGCUGUCGGUGGGU
ENSRNOT00000017878 MI0000924 rno-miR-181c AACAUUCAACCUGUCGGUGAGU
ENSRNOT00000017878 MI0003483 rno-miR-224 CAAGUCACUAGUGGUUCCGUUUA
ENSRNOT00000017878 MI0000862 rno-miR-29b-2* CUGGUUUCACAUGGUGGCUUAG
ENSRNOT00000017878 MI0000626 rno-miR-342-3p UCUCACACAGAAAUCGCACCCGU
ENSRNOT00000017878 MI0000876 rno-miR-34c* AAUCACUAACCACACAGCCAGG
ENSRNOT00000017878 MI0000639 rno-miR-350 UUCACAAAGCCCAUACACUUUCAC
ENSRNOT00000017878 MI0001656 rno-miR-365 UAAUGCCCCUAAAAAUCCUUAU
ENSRNOT00000017878 MI0003551 rno-miR-369-3p AAUAAUACAUGGUUGAUCUUU
ENSRNOT00000017878 MI0003545 rno-miR-376a AUCGUAGAGGAAAAUCCACGU
ENSRNOT00000017878 MI0003545 rno-miR-376a* GGUAGAUUCUCCUUCUAUGAG
ENSRNOT00000017878 MI0003544 rno-miR-376b-3p AUCAUAGAGGAACAUCCACUU
ENSRNOT00000017878 MI0003544 rno-miR-376b-5p GUGGAUAUUCCUUCUAUGGUUA
ENSRNOT00000017878 MI0003478 rno-miR-383 AGAUCAGAAGGUGACUGUGGCU
ENSRNOT00000017878 MI0006146 rno-miR-425 AAUGACACGAUCACUCCCGUUGA
ENSRNOT00000017878 MI0006168 rno-miR-488 UUGAAAGGCUGUUUCUUGGUC
ENSRNOT00000017878 MI0003477 rno-miR-489 AAUGACAUCACAUAUAUGGCAGC
ENSRNOT00000017878 MI0003540 rno-miR-493 UGAAGGUCUACUGUGUGCCAG
ENSRNOT00000017878 MI0006154 rno-miR-532-3p CCUCCCACACCCAAGGCUUGCA
ENSRNOT00000017878 MI0006161 rno-miR-742 GAAAGCCACCAUGUUGGGUAAA
ENSRNOT00000017878 MI0006116 rno-miR-871 UAUUCAGAUUGGUGCCGGUCACA
ENSRNOT00000017878 MI0000881 rno-miR-96 UUUGGCACUAGCACAUUUUUGCU
ENSRNOT00000017878 MI0000883 rno-miR-99a AACCCGUAGAUCCGAUCUUGUG
ENSRNOT00000017878 MI0000884 rno-miR-99b CACCCGUAGAACCGACCUUGCG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Bhongsatiern J, et al. (2005) "Retinal-specific ATP-binding cassette transporter (ABCR/ABCA4) is expressed at the choroid plexus in rat brain." J Neurochem. 92(5):1277-1280. PMID:15715676
  2. [ + ] Cremers FP, et al. (1998) "Autosomal recessive retinitis pigmentosa and cone-rod dystrophy caused by splice site mutations in the Stargardt's disease gene ABCR." Hum Mol Genet. 7(3):355-362. PMID:9466990
  3. [ + ] Allikmets R, et al. (1997) "Mutation of the Stargardt disease gene (ABCR) in age-related macular degeneration." Science. 277(5333):1805-1807. PMID:9295268