ACACA | GeneID:31 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 31 Official Symbol ACACA
Locus N/A Gene Type protein-coding
Synonyms ACAC; ACC; ACC1; ACCA
Full Name acetyl-Coenzyme A carboxylase alpha
Description acetyl-Coenzyme A carboxylase alpha
Chromosome 17q21
Also Known As ACC-alpha; OTTHUMP00000164069; acetyl-CoA carboxylase 1; acetyl-CoA carboxylase-alpha
Summary Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. There are two ACC forms, alpha and beta, encoded by two different genes. ACC-alpha is highly enriched in lipogenic tissues. The enzyme is under long term control at the transcriptional and translational levels and under short term regulation by the phosphorylation/dephosphorylation of targeted serine residues and by allosteric transformation by citrate or palmitoyl-CoA. Multiple alternatively spliced transcript variants divergent in the 5' sequence and encoding distinct isoforms have been found for this gene. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 31015

ID Symbol Protein Species
GeneID:31 ACACA NP_942131.1 Homo sapiens
GeneID:35761 CG11198 NP_610342.1 Drosophila melanogaster
GeneID:60581 Acaca NP_071529.1 Rattus norvegicus
GeneID:107476 Acaca NP_579938.2 Mus musculus
GeneID:281590 ACACA NP_776649.1 Bos taurus
GeneID:396504 ACACA NP_990836.1 Gallus gallus
GeneID:454602 ACACA XP_511428.2 Pan troglodytes
GeneID:491130 ACACA XP_548250.2 Canis lupus familiaris
GeneID:559403 im:7138837 XP_001919815.1 Danio rerio
GeneID:812246 PF14_0664 XP_001348838.1 Plasmodium falciparum
GeneID:840521 ACC1 NP_174849.2 Arabidopsis thaliana
GeneID:855750 ACC1 NP_014413.1 Saccharomyces cerevisiae
GeneID:1274881 AgaP_AGAP005175 XP_314071.2 Anopheles gambiae
GeneID:2543344 cut6 NP_593271.1 Schizosaccharomyces pombe
GeneID:2683533 MGG_07613 XP_367702.2 Magnaporthe grisea
GeneID:2711503 NCU08535.1 XP_329580.1 Neurospora crassa
GeneID:2895282 KLLA0F06072g XP_455355.1 Kluyveromyces lactis
GeneID:4348450 Os10g0363300 NP_001064439.1 Oryza sativa
GeneID:4618419 AGOS_AAR071W NP_982612.1 Eremothecium gossypii

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab31931 Acetyl Coenzyme A Carboxylase (phospho S79) antibody (ab31931); Rabbit polyclonal to Acetyl Coenzyme A Carboxylase (phospho S79)
2 abcam ab72045 acetyl Coenzyme A carboxylase alpha antibody (ab72045); Rabbit polyclonal to acetyl Coenzyme A carboxylase alpha
3 abcam ab72046 acetyl Coenzyme A carboxylase alpha antibody (ab72046); Rabbit polyclonal to acetyl Coenzyme A carboxylase alpha
4 abcam ab63531 Acetyl Coenzyme A Carboxylase antibody (ab63531); Rabbit polyclonal to Acetyl Coenzyme A Carboxylase
5 abcam ab63485 Acetyl Coenzyme A Carboxylase antibody (ab63485); Rabbit polyclonal to Acetyl Coenzyme A Carboxylase
6 abcam ab55177 Acetyl Coenzyme A Carboxylase (phospho S80) antibody (ab55177); Rabbit polyclonal to Acetyl Coenzyme A Carboxylase (phospho S80)
7 abcam ab53688 Acetyl Coenzyme A Carboxylase (phospho S80) antibody (ab53688); Rabbit polyclonal to Acetyl Coenzyme A Carboxylase (phospho S80)
8 abcam ab45174 Acetyl Coenzyme A Carboxylase antibody [EP687Y] (ab45174); Rabbit monoclonal [EP687Y] to Acetyl Coenzyme A Carboxylase
9 abnova H00000031-M01 ACACA monoclonal antibody (M01), clone 6H5; Mouse monoclonal antibody raised against a partial recombinant ACACA.
10 acris AP06367PU-N Acetyl-CoA carboxylase 1; antibody Ab
11 acris AP01517PU-N Acetyl-CoA carboxylase 1 pSer80; antibody Ab
12 acris AP06366PU-N Acetyl-CoA carboxylase 1; antibody Ab
13 acris AP01721PU-N Acetyl-CoA carboxylase 1 pSer80; antibody Ab
14 scbt ACACA ACACA Antibody / ACACA Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ACACA Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ACACA Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0003989 Function acetyl-CoA carboxylase activity
GO:0005524 Function ATP binding
GO:0009374 Function biotin binding
GO:0004075 Function biotin carboxylase activity
GO:0016874 Function ligase activity
GO:0030145 Function manganese ion binding
GO:0046872 Function metal ion binding
GO:0000166 Function nucleotide binding
GO:0005515 Function protein binding
GO:0006633 Process fatty acid biosynthetic process
GO:0008152 Process metabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_198834  UCSC Browser NP_942131
2 NM_198836  UCSC Browser NP_942133 Q13085   B2ZZ90  
3 NM_198837  UCSC Browser NP_942134
4 NM_198838  UCSC Browser NP_942135
5 NM_198839  UCSC Browser NP_942136 Q13085   B2ZZ90  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000353139 MI0000474 hsa-miR-134 UGUGACUGGUUGACCAGAGGGG
ENST00000353139 MI0000487 hsa-miR-193a-3p AACUGGCCUACAAAGUCCCAGU
ENST00000353139 MI0000290 hsa-miR-214* UGCCUGUCUACACUUGCUGUGC
ENST00000353139 MI0004662 mmu-miR-693-5p CAGCCACAUCCGAAAGUUUUC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
6,8-diallyl 5,7-dihydroxy 2-(2-allyl 3-hydroxy 4-methoxyphenyl)1-H benzo(b)pyran-4-one
  • 6,8-diallyl 5,7-dihydroxy 2-(2-allyl 3-hydroxy 4-methoxyphenyl)1-H benzo(b)pyran-4-one results in increased phosphorylation of ACACA protein
16873680
Acetaminophen
  • Acetaminophen affects the expression of ACACA mRNA
17562736
AICA ribonucleotide
  • AICA ribonucleotide results in increased phosphorylation of ACACA protein
16020477
AICA ribonucleotide
  • AICA ribonucleotide results in increased phosphorylation of ACACA protein
16873680, 15297373
Benzene
  • Benzene affects the expression of ACACA mRNA
15878777
dephostatin
  • dephostatin does not affect the expression of ACACA protein
  • dephostatin does not affect the phosphorylation of ACACA protein
15297373
Dihydrotestosterone
  • Dihydrotestosterone results in decreased phosphorylation of ACACA protein
16990341
Estradiol
  • Estradiol results in increased phosphorylation of ACACA protein
15967841
Flavonoids
  • Flavonoids results in increased expression of ACACA mRNA
18035473
Hydrogen Peroxide
  • Hydrogen Peroxide results in increased expression of and results in increased phosphorylation of and results in increased activity of ACACA protein
15297373
Ketone Bodies
  • Ketone Bodies results in decreased expression of ACACA mRNA
16807920
Metformin
  • Metformin results in increased phosphorylation of ACACA protein
16873680
Metformin
  • Metformin results in increased phosphorylation of ACACA protein
16760380
Niacinamide
  • Niacinamide does not affect the reaction [resveratrol results in increased phosphorylation of ACACA protein]
17438283
perfluorooctanoic acid
  • perfluorooctanoic acid results in increased expression of ACACA mRNA
17681415
pirinixic acid
  • pirinixic acid results in increased expression of ACACA mRNA
18301758
resveratrol
  • Niacinamide does not affect the reaction [resveratrol results in increased phosphorylation of ACACA protein]
  • SIRT1 protein does not affect the reaction [resveratrol results in increased phosphorylation of ACACA protein]
  • STK11 protein promotes the reaction [resveratrol results in increased phosphorylation of ACACA protein]
  • sirtinol does not affect the reaction [resveratrol results in increased phosphorylation of ACACA protein]
17438283
resveratrol
  • resveratrol results in increased phosphorylation of ACACA protein
17464184, 17438283
sirtinol
  • sirtinol does not affect the reaction [resveratrol results in increased phosphorylation of ACACA protein]
17438283
Testosterone
  • Testosterone results in increased expression of ACACA mRNA
16579987
Vanadates
  • Vanadates results in increased phosphorylation of ACACA protein
15297373
Zinc
  • Zinc affects the expression of ACACA mRNA
17181878

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Metabolism, Inborn Errors marker
Acrodermatitis inferred via Zinc 17190629, 17202136, 16889938
Alzheimer Disease inferred via Zinc 17119284, 16580781, 16325427, 16410023
Anemia, Sickle Cell inferred via Zinc 16916123
Asthma inferred via Zinc 17085522
Brain Injuries inferred via Zinc 17109824
Carcinoma, Squamous Cell inferred via Zinc 16543248
Cardiovascular Diseases inferred via Zinc 16936243
Diabetes Mellitus inferred via Zinc 16479319
Esophageal Neoplasms inferred via Zinc 16543248
Gastritis inferred via Zinc 17241300
Growth Disorders inferred via Zinc 17217573
Heart Failure inferred via Zinc 17162251
Heart Injuries inferred via Zinc 17074742
Helicobacter Infections inferred via Zinc 17241300
Hepatolenticular Degeneration inferred via Zinc 17276780
Ischemia inferred via Zinc 16584753
Kidney Diseases inferred via Zinc 16960431
Kidney Failure, Chronic inferred via Zinc 16518626
Mammary Neoplasms, Experimental inferred via Zinc 12773700
Pre-Eclampsia inferred via Zinc 17114810
Prostatic Neoplasms inferred via Zinc 12429649, 16700911, 16606632, 16517595
Retinal Degeneration inferred via Zinc 16584753
Tongue Neoplasms inferred via Zinc 16543248
Antisocial Personality Disorder inferred via Testosterone 7506515
Breast Neoplasms inferred via Testosterone 17261762
Firesetting Behavior inferred via Testosterone 7506515
Glioblastoma inferred via Testosterone 17162496
Hirsutism inferred via Testosterone 17019078
Hyperandrogenism inferred via Testosterone 17019078
Hypopituitarism inferred via Testosterone 17426086
Impulse Control Disorders inferred via Testosterone 7506515
Sexual Dysfunction, Physiological inferred via Testosterone 16631401
Adenoma inferred via resveratrol 15688382
Alzheimer Disease inferred via resveratrol 16183991, 16162502
Arthritis, Experimental inferred via resveratrol 17115116
Atherosclerosis inferred via resveratrol 16873680, 17967414
Brain Ischemia inferred via resveratrol 17600658
Breast Neoplasms inferred via resveratrol 17651959, 17534123, 16393696
Carcinoma, Hepatocellular inferred via resveratrol 16227395
Carcinoma, Lewis Lung inferred via resveratrol 16675471
Carcinoma, Squamous Cell inferred via resveratrol 16227395
Cardiovascular Diseases inferred via resveratrol 15458977
Colitis inferred via resveratrol 16474422
Colonic Neoplasms inferred via resveratrol 16338953
Colorectal Neoplasms inferred via resveratrol 16550006
Diabetes Mellitus, Experimental inferred via resveratrol 16873680
Diabetic Nephropathies inferred via resveratrol 16286809
Edema inferred via resveratrol 8985016
Encephalomyelitis, Autoimmune, Experimental inferred via resveratrol 17872969
Enterocolitis, Necrotizing inferred via resveratrol 17923197
Herpes Simplex inferred via resveratrol 16876885
Hypercholesterolemia inferred via resveratrol 17188708
Hyperlipidemias inferred via resveratrol 16873680
Hypertrophy, Left Ventricular inferred via resveratrol 17488730
Infarction, Middle Cerebral Artery inferred via resveratrol 17600658
Inflammation inferred via resveratrol 16366677
Influenza, Human inferred via resveratrol 16624496
Kidney Failure, Acute inferred via resveratrol 16538975
Leukemia, Promyelocytic, Acute inferred via resveratrol 16087638
Lymphoma, B-Cell inferred via resveratrol 17088997
Lymphoma, Non-Hodgkin inferred via resveratrol 14749477
Mammary Neoplasms, Animal inferred via resveratrol 15688416
Mammary Neoplasms, Experimental inferred via resveratrol 8985016, 11606380
Melanoma inferred via resveratrol 17992120
Metabolic Diseases inferred via resveratrol 17112576
Multiple Myeloma inferred via resveratrol 14749477, 17049120, 16267019, 16490592, 17164350, 17935668
Muscular Atrophy, Spinal inferred via resveratrol 17962980
Myocardial Infarction inferred via resveratrol 17188708, 17125593, 16456233, 16317513, 17015251, 16525036
Myocardial Ischemia inferred via resveratrol 17125593, 17015251
Myocarditis inferred via resveratrol 17322642
Neoplasms, Experimental inferred via resveratrol 8985016
Neurodegenerative Diseases inferred via resveratrol 17652729
Neurogenic Inflammation inferred via resveratrol 17929310
Osteoporosis, Postmenopausal inferred via resveratrol 17513867
Prenatal Exposure Delayed Effects inferred via resveratrol 16679765
Prostatic Neoplasms inferred via resveratrol 17675339, 16731767, 15767336, 17804756, 17718901, 17636462
Renal Insufficiency, Chronic inferred via resveratrol 16325855
Reperfusion Injury inferred via resveratrol 17058453, 16314181, 16317513, 17520802, 15827377
Skin Neoplasms inferred via resveratrol 15837718, 8985016
STROKE, ISCHEMIC inferred via resveratrol 16321402
Tongue Neoplasms inferred via resveratrol 16227395
Uterine Cervical Neoplasms inferred via resveratrol 17473185
Uterine Neoplasms inferred via resveratrol 17044934
Ventricular Dysfunction, Left inferred via resveratrol 17488730
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375
Edema inferred via perfluorooctanoic acid 17259670, 12083418
Hepatomegaly inferred via perfluorooctanoic acid 3609246
Hyperalgesia inferred via perfluorooctanoic acid 12083418
Inflammation inferred via perfluorooctanoic acid 12083418
Leydig Cell Tumor inferred via perfluorooctanoic acid 8812269
Liver Neoplasms inferred via perfluorooctanoic acid 14757943
Niemann-Pick Disease, Type C inferred via perfluorooctanoic acid 9802331
Prenatal Exposure Delayed Effects inferred via perfluorooctanoic acid 17132714
Pemphigoid, Bullous inferred via Niacinamide 11026799
Diabetes Mellitus inferred via Metformin 17446233
Diabetic Angiopathies inferred via Metformin 16385087
Hyperandrogenism inferred via Metformin 15356085, 17062894
Insulin Resistance inferred via Metformin 17062894
Polycystic Ovary Syndrome inferred via Metformin 15356085, 17062894
Cardiovascular Diseases inferred via Hydrogen Peroxide 16936243
Kidney Failure, Chronic inferred via Hydrogen Peroxide 16518626
Inflammation inferred via Flavonoids 17296493
Breast Neoplasms inferred via Estradiol 17289903, 14630087, 18497071, 17261762, 17018787, 12948864
Candidiasis, Vulvovaginal inferred via Estradiol 16111702
Carcinoma, Hepatocellular inferred via Estradiol 16924424
Herpes Genitalis inferred via Estradiol 15709030
Hot Flashes inferred via Estradiol 17088409
Insulin Resistance inferred via Estradiol 16393666, 16627594
Kidney Diseases inferred via Estradiol 15618244
Kidney Neoplasms inferred via Estradiol 15610895
Liver Cirrhosis, Experimental inferred via Estradiol 14716833, 14659978
Mammary Neoplasms, Experimental inferred via Estradiol 17203775, 16891317, 11408345, 11807958
Myocardial Reperfusion Injury inferred via Estradiol 16810080
Neovascularization, Pathologic inferred via Estradiol 17289903
Prostatic Neoplasms inferred via Estradiol 16740699
Anemia, Aplastic inferred via Benzene 14761424, 11369114, 17661222
Bone Marrow Diseases inferred via Benzene 16183116
Breast Neoplasms inferred via Benzene 11921183, 17162533
Dermatitis inferred via Benzene 15902427
Hematologic Diseases inferred via Benzene 16183116
Hypertension inferred via Benzene 17940673
Leukemia inferred via Benzene 15935818, 17119257, 14694614, 18335105
Leukemia, Myeloid inferred via Benzene 17506065
Lung Diseases, Interstitial inferred via Benzene 14698565
Lymphoma inferred via Benzene 17119257, 17584886
Multiple Myeloma inferred via Benzene 17119195
Occupational Diseases inferred via Benzene 17479406, 15727169, 15935809, 17178637, 15612468, 15913788, 15576619, 16737584, 17119257
Thymus Neoplasms inferred via Benzene 10850423
Hepatitis, Toxic inferred via Acetaminophen 2444490, 16081117, 17522070, 14986274, 15968718, 16227642, 16177239, 17562736
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
BRCA1 BRCA1 / ACACA Affinity Capture-MS Magnard C (2002)
BRCA1 BRCA1 / ACACA Affinity Capture-Western Magnard C (2002)
CHGB ACACA / CHGB Two-hybrid Stelzl U (2005)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Ruano G, et al. (2009) "Physiogenomic comparison of edema and BMI in patients receiving rosiglitazone or pioglitazone." Clin Chim Acta. 400(1-2):48-55. PMID:18996102
  2. [ + ] Ray H, et al. (2009) "Cell cycle regulation of the BRCA1/acetyl-CoA-carboxylase complex." Biochem Biophys Res Commun. 378(3):615-619. PMID:19061860
  3. [ + ] Yatscoff MA, et al. (2008) "Myocardial hypertrophy and the maturation of fatty acid oxidation in the newborn human heart." Pediatr Res. 64(6):643-647. PMID:18614968
  4. [ + ] Lee-Young RS, et al. (2008) "Acute exercise does not cause sustained elevations in AMPK signaling or expression." Med Sci Sports Exerc. 40(8):1490-1494. PMID:18614941
  5. [ + ] Oshikawa M, et al. (2008) "Fine expression profiling of full-length transcripts using a size-unbiased cDNA library prepared with the vector-capping method." DNA Res. 15(3):123-136. PMID:18487259
  6. [ + ] Locke GA, et al. (2008) "Differential activation of recombinant human acetyl-CoA carboxylases 1 and 2 by citrate." Arch Biochem Biophys. 475(1):72-79. PMID:18455495
  7. [ + ] Shen Y, et al. (2008) "Structural evidence for direct interactions between the BRCT domains of human BRCA1 and a phospho-peptide from human ACC1." Biochemistry. 47(21):5767-5773. PMID:18452305
  8. [ + ] Lu Y, et al. (2008) "Multiple genetic variants along candidate pathways influence plasma high-density lipoprotein cholesterol concentrations." J Lipid Res. 49(12):2582-2589. PMID:18660489
  9. [ + ] Ma J, et al. (2008) "Aldo-keto reductase family 1 B10 affects fatty acid synthesis by regulating the stability of acetyl-CoA carboxylase-alpha in breast cancer cells." J Biol Chem. 283(6):3418-3423. PMID:18056116
  10. [ + ] de Leon J, et al. (2008) "Exploring genetic variations that may be associated with the direct effects of some antipsychotics on lipid levels." Schizophr Res. 98(1-3):40-46. PMID:18031993
  11. [ + ] Sinilnikova OM, et al. (2007) "Haplotype-based analysis of common variation in the acetyl-coA carboxylase alpha gene and breast cancer risk: a case-control study nested within the European Prospective Investigation into Cancer and Nutrition." Cancer Epidemiol Biomarkers Prev. 16(3):409-415. PMID:17372234
  12. [ + ] Yoon S, et al. (2007) "Up-regulation of acetyl-CoA carboxylase alpha and fatty acid synthase by human epidermal growth factor receptor 2 at the translational level in breast cancer cells." J Biol Chem. 282(36):26122-26131. PMID:17631500
  13. [ + ] Conde E, et al. (2007) "Specific pattern of LKB1 and phospho-acetyl-CoA carboxylase protein immunostaining in human normal tissues and lung carcinomas." Hum Pathol. 38(9):1351-1360. PMID:17521700
  14. [ + ] Moreau K, et al. (2006) "BRCA1 affects lipid synthesis through its interaction with acetyl-CoA carboxylase." J Biol Chem. 281(6):3172-3181. PMID:16326698
  15. [ + ] Olsen JV, et al. (2006) "Global, in vivo, and site-specific phosphorylation dynamics in signaling networks." Cell. 127(3):635-648. PMID:17081983
  16. [ + ] Ray H, et al. (2006) "ACCA phosphopeptide recognition by the BRCT repeats of BRCA1." J Mol Biol. 359(4):973-982. PMID:16698035
  17. [ + ] Lim J, et al. (2006) "A protein-protein interaction network for human inherited ataxias and disorders of Purkinje cell degeneration." Cell. 125(4):801-814. PMID:16713569
  18. [ + ] Stelzl U, et al. (2005) "A human protein-protein interaction network: a resource for annotating the proteome." Cell. 122(6):957-968. PMID:16169070
  19. [ + ] Travers MT, et al. (2005) "Asymmetric expression of transcripts derived from the shared promoter between the divergently oriented ACACA and TADA2L genes." Genomics. 85(1):71-84. PMID:15607423
  20. [ + ] Sinilnikova OM, et al. (2004) "Acetyl-CoA carboxylase alpha gene and breast cancer susceptibility." Carcinogenesis. 25(12):2417-2424. PMID:15333468
  21. [ + ] Beausoleil SA, et al. (2004) "Large-scale characterization of HeLa cell nuclear phosphoproteins." Proc Natl Acad Sci U S A. 101(33):12130-12135. PMID:15302935
  22. [ + ] Travers MT, et al. (2003) "Characterisation of an N-terminal variant of acetyl-CoA carboxylase-alpha: expression in human tissues and evolutionary aspects." Biochim Biophys Acta. 1634(3):97-106. PMID:14643797
  23. [ + ] Mao J, et al. (2003) "Human acetyl-CoA carboxylase 1 gene: presence of three promoters and heterogeneity at the 5'-untranslated mRNA region." Proc Natl Acad Sci U S A. 100(13):7515-7520. PMID:12810950
  24. [ + ] Magnard C, et al. (2002) "BRCA1 interacts with acetyl-CoA carboxylase through its tandem of BRCT domains." Oncogene. 21(44):6729-6739. PMID:12360400
  25. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  26. [ + ] Dias Neto E, et al. (2000) "Shotgun sequencing of the human transcriptome with ORF expressed sequence tags." Proc Natl Acad Sci U S A. 97(7):3491-3496. PMID:10737800
  27. [ + ] Chen ZP, et al. (2000) "AMPK signaling in contracting human skeletal muscle: acetyl-CoA carboxylase and NO synthase phosphorylation." Am J Physiol Endocrinol Metab. 279(5):E1202-E1206. PMID:11052978
  28. [ + ] Abu-Elheiga L, et al. (2000) "The subcellular localization of acetyl-CoA carboxylase 2." Proc Natl Acad Sci U S A. 97(4):1444-1449. PMID:10677481
  29. [ + ] Abu-Elheiga L, et al. (1995) "Human acetyl-CoA carboxylase: characterization, molecular cloning, and evidence for two isoforms." Proc Natl Acad Sci U S A. 92(9):4011-4015. PMID:7732023
  30. [ + ] Ha J, et al. (1994) "Critical phosphorylation sites for acetyl-CoA carboxylase activity." J Biol Chem. 269(35):22162-22168. PMID:7915280
  31. [ + ] Mohamed AH, et al. (1994) "Isolation and characterization of a novel acetyl-CoA carboxylase kinase from rat liver." J Biol Chem. 269(9):6859-6865. PMID:7907095
  32. [ + ] Ha J, et al. (1994) "Cloning of human acetyl-CoA carboxylase cDNA." Eur J Biochem. 219(1-2):297-306. PMID:7905825
  33. [ + ] Haystead TA, et al. (1988) "Analysis of sites phosphorylated on acetyl-CoA carboxylase in response to insulin in isolated adipocytes. Comparison with sites phosphorylated by casein kinase-2 and the calmodulin-dependent multiprotein kinase." Eur J Biochem. 175(2):347-354. PMID:2900140
  34. [ + ] Milatovich A, et al. (1988) "Localization of the gene for acetyl-CoA carboxylase to human chromosome 17." Cytogenet Cell Genet. 48(3):190-192. PMID:2906852
  35. [ + ] Munday MR, et al. (1988) "Identification by amino acid sequencing of three major regulatory phosphorylation sites on rat acetyl-CoA carboxylase." Eur J Biochem. 175(2):331-338. PMID:2900138