aanat2 | GeneID:30685 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 30685 Official Symbol aanat2
Locus N/A Gene Type protein-coding
Synonyms AA-NAT
Full Name arylalkylamine N-acetyltransferase
Description arylalkylamine N-acetyltransferase
Chromosome N/A
Also Known As serotonin N-acetyltransferase-2; zfaanat2
Summary N/A

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016407 Function acetyltransferase activity
GO:0008415 Function acyltransferase activity
GO:0004059 Function aralkylamine N-acetyltransferase activity
GO:0008080 Function N-acetyltransferase activity
GO:0016740 Function transferase activity
GO:0007623 Process circadian rhythm
GO:0008152 Process metabolic process
GO:0009648 Process photoperiodism
GO:0009416 Process response to light stimulus

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_131411 NP_571486 Q6PCA1   Q9PVD7  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000018205 MI0002051 dre-miR-218a UUGUGCUUGAUCUAACCAUGUG
ENSDART00000018205 MI0002052 dre-miR-218a UUGUGCUUGAUCUAACCAUGUG
ENSDART00000018205 MI0002053 dre-miR-218b UUGUGCUUGAUCUAACCAUGCA
ENSDART00000018205 MI0002063 dre-miR-338 UCCAGCAUCAGUGAUUUUGUUG
ENSDART00000018205 MI0002064 dre-miR-338 UCCAGCAUCAGUGAUUUUGUUG
ENSDART00000018205 MI0002065 dre-miR-338 UCCAGCAUCAGUGAUUUUGUUG
ENSDART00000018205 MI0002066 dre-miR-338 UCCAGCAUCAGUGAUUUUGUUG
ENSDART00000018205 MI0004777 dre-miR-732 CUCAAAGCAGAGAACUCUCGGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Chen H, et al. (2007) "Expression of the G protein gammaT1 subunit during zebrafish development." Gene Expr Patterns. 7(5):574-583. PMID:17306630
  2. [ + ] Dickmeis T, et al. (2007) "Glucocorticoids play a key role in circadian cell cycle rhythms." PLoS Biol. 5(4):e78. PMID:17373855
  3. [ + ] Ziv L, et al. (2006) "Circadian time-keeping during early stages of development." Proc Natl Acad Sci U S A. 103(11):4146-4151. PMID:16537499
  4. [ + ] Appelbaum L, et al. (2006) "Zebrafish arylalkylamine-N-acetyltransferase genes - targets for regulation of the circadian clock." J Mol Endocrinol. 36(2):337-347. PMID:16595704
  5. [ + ] Appelbaum L, et al. (2006) "Mechanism of pineal-specific gene expression: the role of E-box and photoreceptor conserved elements." Mol Cell Endocrinol. 252(1-2):27-33. PMID:16647808
  6. [ + ] Zilberman-Peled B, et al. (2006) "A possible new role for fish retinal serotonin-N-acetyltransferase-1 (AANAT1): Dopamine metabolism." Brain Res. 1073-1074():220-228. PMID:16427617
  7. [ + ] Ziv L, et al. (2006) "Period2 expression pattern and its role in the development of the pineal circadian clock in zebrafish." Chronobiol Int. 23(1-2):101-112. PMID:16687284
  8. [ + ] Vuilleumier R, et al. (2006) "Starting the zebrafish pineal circadian clock with a single photic transition." Endocrinology. 147(5):2273-2279. PMID:16497800
  9. [ + ] Leung YF, et al. (2005) "Gene expression profiling of zebrafish embryonic retina." Zebrafish. 2(4):269-283. PMID:18248185
  10. [ + ] Appelbaum L, et al. (2005) "Homeobox-clock protein interaction in zebrafish. A shared mechanism for pineal-specific and circadian gene expression." J Biol Chem. 280(12):11544-11551. PMID:15657039
  11. [ + ] Ziv L, et al. (2005) "Functional development of the zebrafish pineal gland: light-induced expression of period2 is required for onset of the circadian clock." J Neuroendocrinol. 17(5):314-320. PMID:15869567
  12. [ + ] Woods IG, et al. (2005) "The zebrafish gene map defines ancestral vertebrate chromosomes." Genome Res. 15(9):1307-1314. PMID:16109975
  13. [ + ] Zilberman-Peled B, et al. (2004) "Duality of serotonin-N-acetyltransferase in the gilthead seabream (Sparus aurata): molecular cloning and characterization of recombinant enzymes." Gen Comp Endocrinol. 138(2):139-147. PMID:15302263
  14. [ + ] Appelbaum L, et al. (2004) "Zebrafish serotonin-N-acetyltransferase-2 gene regulation: pineal-restrictive downstream module contains a functional E-box and three photoreceptor conserved elements." Mol Endocrinol. 18(5):1210-1221. PMID:14988431
  15. [ + ] Falcon J, et al. (2003) "Genetic, temporal and developmental differences between melatonin rhythm generating systems in the teleost fish pineal organ and retina." J Neuroendocrinol. 15(4):378-382. PMID:12622837
  16. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  17. [ + ] Begay V, et al. (1998) "Transcripts encoding two melatonin synthesis enzymes in the teleost pineal organ: circadian regulation in pike and zebrafish, but not in trout." Endocrinology. 139(3):905-912. PMID:9492019