acat2 | GeneID:30643 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 30643 Official Symbol acat2
Locus CH211-195E3.3 Gene Type protein-coding
Synonyms fb10a06; fb53f08; wu:fb10a06; wu:fb53f08
Full Name acetyl-CoA acetyltransferase 2
Description acetyl-CoA acetyltransferase 2
Chromosome N/A
Also Known As etID39354.20
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 55855

ID Symbol Protein Species
GeneID:39 ACAT2 NP_005882.2 Homo sapiens
GeneID:30643 acat2 NP_571445.2 Danio rerio
GeneID:38147 CG9149 NP_612094.2 Drosophila melanogaster
GeneID:110460 Acat2 NP_033364.1 Mus musculus
GeneID:224530 Acat3 NP_694791.2 Mus musculus
GeneID:308100 Acat2 NP_001006996.1 Rattus norvegicus
GeneID:421587 ACAT2 NP_001034376.1 Gallus gallus
GeneID:484063 ACAT2 XP_541180.2 Canis lupus familiaris
GeneID:512044 ACAT2 NP_001069017.1 Bos taurus
GeneID:1281861 AgaP_AGAP001318 XP_321828.2 Anopheles gambiae

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0003824 Function catalytic activity
GO:0016740 Function transferase activity
GO:0008152 Process metabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_131370 NP_571445

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000006778 MI0003343 dre-let-7j UGAGGUAGUUGUUUGUACAGUU
ENSDART00000006778 MI0001877 dre-miR-1 UGGAAUGUAAAGAAGUAUGUAU
ENSDART00000006778 MI0001878 dre-miR-1 UGGAAUGUAAAGAAGUAUGUAU
ENSDART00000006778 MI0001972 dre-miR-125a UCCCUGAGACCCUUAACCUGUG
ENSDART00000006778 MI0001973 dre-miR-125a UCCCUGAGACCCUUAACCUGUG
ENSDART00000006778 MI0001975 dre-miR-125b UCCCUGAGACCCUAACUUGUGA
ENSDART00000006778 MI0001976 dre-miR-125b UCCCUGAGACCCUAACUUGUGA
ENSDART00000006778 MI0001977 dre-miR-125b UCCCUGAGACCCUAACUUGUGA
ENSDART00000006778 MI0001978 dre-miR-125c UCCCUGAGACCCUAACUCGUGA
ENSDART00000006778 MI0001980 dre-miR-128 UCACAGUGAACCGGUCUCUUUU
ENSDART00000006778 MI0001981 dre-miR-128 UCACAGUGAACCGGUCUCUUUU
ENSDART00000006778 MI0001993 dre-miR-133a* AGCUGGUAAAAUGGAACCAAAU
ENSDART00000006778 MI0002002 dre-miR-138 AGCUGGUGUUGUGAAUCAGGCC
ENSDART00000006778 MI0001372 dre-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENSDART00000006778 MI0002035 dre-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENSDART00000006778 MI0001922 dre-miR-25 CAUUGCACUUGUCUCGGUCUGA
ENSDART00000006778 MI0002061 dre-miR-301b CAGUGCAAUAGUAUUGUCAUUG
ENSDART00000006778 MI0001940 dre-miR-30a UGUAAACAUUCCCGACUGGAAG
ENSDART00000006778 MI0001941 dre-miR-30b UGUAAACAUCCUACACUCAGCU
ENSDART00000006778 MI0001944 dre-miR-30c UGUAAACAUCCUACACUCUCAG
ENSDART00000006778 MI0001946 dre-miR-30d UGUAAACAUCCCCGACUGGAAG
ENSDART00000006778 MI0001950 dre-miR-30e UGUAAACAUCCUUGACUGGAAG
ENSDART00000006778 MI0003690 dre-miR-34b UAGGCAGUGUUGUUAGCUGAUUG
ENSDART00000006778 MI0004774 dre-miR-34c AGGCAGUGCAGUUAGUUGAUUAC
ENSDART00000006778 MI0002067 dre-miR-363 AAUUGCACGGUAUCCAUCUGUA
ENSDART00000006778 MI0002076 dre-miR-454b UAGUGCAAUAUUGCUUAUAGGG
ENSDART00000006778 MI0001951 dre-miR-92a UAUUGCACUUGUCCCGGCCUGU
ENSDART00000006778 MI0001952 dre-miR-92a UAUUGCACUUGUCCCGGCCUGU
ENSDART00000006778 MI0001953 dre-miR-92b UAUUGCACUCGUCCCGGCCUCC
ENSDART00000006778 MI0001955 dre-miR-96 UUUGGCACUAGCACAUUUUUGCU
ENSDART00000006778 MI0003413 fru-miR-189 GUGCCUACUGAACUGGUAUCAGU
ENSDART00000006778 MI0004957 xtr-miR-449 AGGCAGUGUAAUGUUAGCUGGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

AAD34966   AAH45949   AAI65310   CAI11705   CAI11706   NP_571445   Q5SPA3   Q5SPA4   Q7ZU18   Q9W795  

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Woods IG, et al. (2005) "The zebrafish gene map defines ancestral vertebrate chromosomes." Genome Res. 15(9):1307-1314. PMID:16109975
  2. [ + ] Liu RZ, et al. (2004) "Differential expression of duplicated genes for brain-type fatty acid-binding proteins (fabp7a and fabp7b) during early development of the CNS in zebrafish (Danio rerio)." Gene Expr Patterns. 4(4):379-387. PMID:15183304
  3. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932