Abca3 | GeneID:302973 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 302973 Official Symbol Abca3
Locus N/A Gene Type protein-coding
Synonyms
Full Name ATP-binding cassette, sub-family A (ABC1), member 3
Description ATP-binding cassette, sub-family A (ABC1), member 3
Chromosome 10q12
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 37437

ID Symbol Protein Species
GeneID:21 ABCA3 NP_001080.2 Homo sapiens
GeneID:27410 Abca3 NP_001034670.1 Mus musculus
GeneID:33103 CG1718 NP_608445.1 Drosophila melanogaster
GeneID:178559 abt-4 NP_503175.1 Caenorhabditis elegans
GeneID:302973 Abca3 XP_220219.4 Rattus norvegicus
GeneID:416386 ABCA3 XP_414701.2 Gallus gallus
GeneID:453833 ABCA3 XP_510744.2 Pan troglodytes
GeneID:479879 ABCA3 XP_537004.2 Canis lupus familiaris
GeneID:505787 ABCA3 XP_582132.3 Bos taurus
GeneID:1269722 AgaP_AGAP007504 XP_308371.2 Anopheles gambiae
GeneID:1276992 AgaP_AGAP006379 XP_557048.1 Anopheles gambiae
GeneID:1280527 AgaP_AGAP012156 XP_552044.1 Anopheles gambiae

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0042599 Component lamellar body
GO:0016020 Component membrane
GO:0005886 Component plasma membrane
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0051384 Process response to glucocorticoid stimulus
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_001054547  UCSC Browser XP_001054547
2 XM_001054596  UCSC Browser XP_001054596
3 XM_001054650  UCSC Browser XP_001054650
4 XM_001054721  UCSC Browser XP_001054721
5 XM_220219  UCSC Browser XP_220219

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000060781 MI0004999 gga-miR-757 GCAGAGCUGCAGAUGGGAUUC
ENSRNOT00000060781 MI0005000 gga-miR-757 GCAGAGCUGCAGAUGGGAUUC
ENSRNOT00000060781 MI0003193 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
ENSRNOT00000060781 MI0003167 hsa-miR-516b AUCUGGAGGUAAGAAGCACUUU
ENSRNOT00000060781 MI0003172 hsa-miR-516b AUCUGGAGGUAAGAAGCACUUU
ENSRNOT00000060781 MI0003152 hsa-miR-525-5p CUCCAGAGGGAUGCACUUUCU
ENSRNOT00000060781 MI0003627 hsa-miR-614 GAACGCCUGUUCUUGCCAGGUGG
ENSRNOT00000060781 MI0003642 hsa-miR-628-5p AUGCUGACAUAUUUACUAGAGG
ENSRNOT00000060781 MI0003658 hsa-miR-643 ACUUGUAUGCUAGCUCAGGUAG
ENSRNOT00000060781 MI0003763 hsa-miR-767-3p UCUGCUCAUACCCCAUGGUUUCU
ENSRNOT00000060781 MI0005534 hsa-miR-891b UGCAACUUACCUGAGUCAUUGA
ENSRNOT00000060781 MI0005538 hsa-miR-892b CACUGGCUCCUUUCUGGGUAGA
ENSRNOT00000060781 MI0005755 hsa-miR-933 UGUGCGCAGGGAGACCUCUCCC
ENSRNOT00000060781 MI0005759 hsa-miR-937 AUCCGCGCUCUGACUCUCUGCC
ENSRNOT00000060781 MI0000171 mmu-miR-149 UCUGGCUCCGUGUCUUCACUCCC
ENSRNOT00000060781 MI0000245 mmu-miR-202-5p UUCCUAUGCAUAUACUUCUUU
ENSRNOT00000060781 MI0005003 mmu-miR-676 CCGUCCUGAGGUUGUUGAGCU
ENSRNOT00000060781 MI0004698 mmu-miR-713 UGCACUGAAGGCACACAGC
ENSRNOT00000060781 MI0004124 mmu-miR-744 UGCGGGGCUAGGGCUAACAGCA
ENSRNOT00000060781 MI0004516 mmu-miR-763 CCAGCUGGGAAGAACCAGUGGC
ENSRNOT00000060781 MI0000892 rno-miR-124 UAAGGCACGCGGUGAAUGCC
ENSRNOT00000060781 MI0000893 rno-miR-124 UAAGGCACGCGGUGAAUGCC
ENSRNOT00000060781 MI0000894 rno-miR-124 UAAGGCACGCGGUGAAUGCC
ENSRNOT00000060781 MI0000954 rno-miR-214 ACAGCAGGCACAGACAGGCAG
ENSRNOT00000060781 MI0000957 rno-miR-218 UUGUGCUUGAUCUAACCAUGU
ENSRNOT00000060781 MI0000958 rno-miR-218 UUGUGCUUGAUCUAACCAUGU
ENSRNOT00000060781 MI0000870 rno-miR-30a UGUAAACAUCCUCGACUGGAAG
ENSRNOT00000060781 MI0000868 rno-miR-30b-5p UGUAAACAUCCUACACUCAGCU
ENSRNOT00000060781 MI0000866 rno-miR-30c UGUAAACAUCCUACACUCUCAGC
ENSRNOT00000060781 MI0000871 rno-miR-30c UGUAAACAUCCUACACUCUCAGC
ENSRNOT00000060781 MI0000869 rno-miR-30d UGUAAACAUCCCCGACUGGAAG
ENSRNOT00000060781 MI0000867 rno-miR-30e UGUAAACAUCCUUGACUGGAAG
ENSRNOT00000060781 MI0000636 rno-miR-349 CAGCCCUGCUGUCUUAACCUCU
ENSRNOT00000060781 MI0003545 rno-miR-376a AUCGUAGAGGAAAAUCCACGU
ENSRNOT00000060781 MI0003544 rno-miR-376b-3p AUCAUAGAGGAACAUCCACUU
ENSRNOT00000060781 MI0003719 rno-miR-378* CUCCUGACUCCAGGUCCUGUGU
ENSRNOT00000060781 MI0003541 rno-miR-379* CUAUGUAACAUGGUCCACUAAC
ENSRNOT00000060781 MI0003477 rno-miR-489 AAUGACAUCACAUAUAUGGCAGC
ENSRNOT00000060781 MI0006154 rno-miR-532-3p CCUCCCACACCCAAGGCUUGCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Whitsett JA, et al. (2005) "Genetic disorders of surfactant homeostasis." Biol Neonate. 87(4):283-287. PMID:15985750
  2. [ + ] Yoshida I, et al. (2004) "Expression of ABCA3, a causative gene for fatal surfactant deficiency, is up-regulated by glucocorticoids in lung alveolar type II cells." Biochem Biophys Res Commun. 323(2):547-555. PMID:15369786
  3. [ + ] Mulugeta S, et al. (2002) "Identification of LBM180, a lamellar body limiting membrane protein of alveolar type II cells, as the ABC transporter protein ABCA3." J Biol Chem. 277(25):22147-22155. PMID:11940594
  4. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932