A2bp1 | GeneID:302920 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 302920 Official Symbol A2bp1
Locus N/A Gene Type protein-coding
Synonyms
Full Name ataxin 2 binding protein 1
Description ataxin 2 binding protein 1
Chromosome 10q12
Also Known As
Summary This gene was previously named "bol, boule-like (Drosophila)" with a symbol of "Boll_predicted". The nomenclature was updated to reflect its similarity to ataxin 2-binding protein 1. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 69339

ID Symbol Protein Species
GeneID:54715 A2BP1 NP_665898.1 Homo sapiens
GeneID:268859 A2bp1 NP_899011.1 Mus musculus
GeneID:302920 A2bp1 XP_220155.3 Rattus norvegicus
GeneID:416645 A2BP1 XP_414942.2 Gallus gallus
GeneID:449554 a2bp1 NP_001005596.1 Danio rerio
GeneID:609116 LOC609116 XP_851461.1 Canis lupus familiaris

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005802 Component trans-Golgi network
GO:0003676 Function nucleic acid binding
GO:0000166 Function nucleotide binding
GO:0008022 Function protein C-terminus binding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001106974  UCSC Browser NP_001100444
2 XM_001076609  UCSC Browser XP_001076609
3 XM_220155  UCSC Browser XP_220155

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000003813 MI0003180 hsa-miR-516a-3p UGCUUCCUUUCAGAGGGU
ENSRNOT00000003813 MI0003181 hsa-miR-516a-3p UGCUUCCUUUCAGAGGGU
ENSRNOT00000003813 MI0003580 hsa-miR-573 CUGAAGUGAUGUGUAACUGAUCAG
ENSRNOT00000003813 MI0003618 hsa-miR-605 UAAAUCCCAUGGUGCCUUCUCCU
ENSRNOT00000003813 MI0003635 hsa-miR-621 GGCUAGCAACAGCGCUUACCU
ENSRNOT00000003813 MI0003649 hsa-miR-634 AACCAGCACCCCAACUUUGGAC
ENSRNOT00000003813 MI0003670 hsa-miR-662 UCCCACGUUGUGGCCCAGCAG
ENSRNOT00000003813 MI0000245 mmu-miR-202-3p AGAGGUAUAGCGCAUGGGAAGA
ENSRNOT00000003813 MI0004687 mmu-miR-703 AAAACCUUCAGAAGGAAAGAA
ENSRNOT00000003813 MI0004700 mmu-miR-715 CUCCGUGCACACCCCCGCGUG
ENSRNOT00000003813 MI0000895 rno-miR-125a-5p UCCCUGAGACCCUUUAACCUGUGA
ENSRNOT00000003813 MI0000896 rno-miR-125b-5p UCCCUGAGACCCUAACUUGUGA
ENSRNOT00000003813 MI0000897 rno-miR-125b-5p UCCCUGAGACCCUAACUUGUGA
ENSRNOT00000003813 MI0000917 rno-miR-144 UACAGUAUAGAUGAUGUACU
ENSRNOT00000003813 MI0000947 rno-miR-205 UCCUUCAUUCCACCGGAGUCUG
ENSRNOT00000003813 MI0000608 rno-miR-331 GCCCCUGGGCCUAUCCUAGAA
ENSRNOT00000003813 MI0000635 rno-miR-347 UGUCCCUCUGGGUCGCCCA
ENSRNOT00000003813 MI0003551 rno-miR-369-5p AGAUCGACCGUGUUAUAUUCGC
ENSRNOT00000003813 MI0003545 rno-miR-376a AUCGUAGAGGAAAAUCCACGU
ENSRNOT00000003813 MI0003544 rno-miR-376b-3p AUCAUAGAGGAACAUCCACUU
ENSRNOT00000003813 MI0003544 rno-miR-376b-5p GUGGAUAUUCCUUCUAUGGUUA
ENSRNOT00000003813 MI0006114 rno-miR-466c UGUGAUGUGUGCAUGUACAUG
ENSRNOT00000003813 MI0006150 rno-miR-471 UACGUAGUAUAGUGCUUUUCAC
ENSRNOT00000003813 MI0006126 rno-miR-883 UAACUGCAACAUCUCUCAGUAU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene