Abcb7 | GeneID:302395 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 302395 Official Symbol Abcb7
Locus N/A Gene Type protein-coding
Synonyms
Full Name ATP-binding cassette, sub-family B (MDR/TAP), member 7
Description ATP-binding cassette, sub-family B (MDR/TAP), member 7
Chromosome Xq31
Also Known As ATP-binding cassette, sub-family B, member 7, mitochondrial
Summary mouse homolog plays a role in heme biosynthesis in erythroid cells; regulates expression of both the mitochondrial iron-sulfur-containing protein ferrochelatase and the cytosolic iron-sulfur containing protein thioredoxin [RGD]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 3175

ID Symbol Protein Species
GeneID:22 ABCB7 NP_004290.2 Homo sapiens
GeneID:38193 CG7955 NP_728642.2 Drosophila melanogaster
GeneID:171807 abtm-1 NP_001021830.1 Caenorhabditis elegans
GeneID:302395 Abcb7 NP_997683.1 Rattus norvegicus
GeneID:422326 ABCB7 XP_420301.1 Gallus gallus
GeneID:491967 ABCB7 XP_549087.1 Canis lupus familiaris
GeneID:533669 ABCB7 XP_613148.2 Bos taurus
GeneID:566515 wu:fc20c02 XP_694879.2 Danio rerio
GeneID:828980 ATM2 NP_194591.1 Arabidopsis thaliana
GeneID:828981 ATM1 NP_567813.1 Arabidopsis thaliana
GeneID:835939 STA1 NP_200635.1 Arabidopsis thaliana
GeneID:855347 ATM1 NP_014030.1 Saccharomyces cerevisiae
GeneID:1276974 AgaP_AGAP006364 XP_316391.2 Anopheles gambiae
GeneID:2542779 atm1 NP_594288.2 Schizosaccharomyces pombe
GeneID:2676565 MGG_03406 XP_360863.1 Magnaporthe grisea
GeneID:2706358 NCU05029.1 XP_324386.1 Neurospora crassa
GeneID:2896392 KLLA0A10131g XP_451443.1 Kluyveromyces lactis
GeneID:4622625 AGOS_AGL335W NP_986332.1 Eremothecium gossypii

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005575 Component cellular_component
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0005743 Component mitochondrial inner membrane
GO:0005739 Component mitochondrion
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0003674 Function molecular_function
GO:0000166 Function nucleotide binding
GO:0008150 Process biological_process
GO:0006879 Process cellular iron ion homeostasis
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_212518  UCSC Browser NP_997683

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000003739 MI0003630 hsa-miR-548c-3p CAAAAAUCUCAAUUACUUUUGC
ENSRNOT00000003739 MI0003561 hsa-miR-555 AGGGUAAGCUGAACCUCUGAU
ENSRNOT00000003739 MI0003565 hsa-miR-559 UAAAGUAAAUAUGCACCAAAA
ENSRNOT00000003739 MI0003583 hsa-miR-576-5p AUUCUAAUUUCUCCACGUCUUU
ENSRNOT00000003739 MI0003591 hsa-miR-584 UUAUGGUUUGCCUGGGACUGAG
ENSRNOT00000003739 MI0003656 hsa-miR-641 AAAGACAUAGGAUAGAGUCACCUC
ENSRNOT00000003739 MI0002402 mmu-miR-467a UAAGUGCCUGCAUGUAUAUGCG
ENSRNOT00000003739 MI0004699 mmu-miR-714 CGACGAGGGCCGGUCGGUCGC
ENSRNOT00000003739 MI0004708 mmu-miR-721 CAGUGCAAUUAAAAGGGGGAA
ENSRNOT00000003739 MI0004249 mmu-miR-802 UCAGUAACAAAGAUUCAUCCUU
ENSRNOT00000003739 MI0005203 mmu-miR-804 UGUGAGUUGUUCCUCACCUGGA
ENSRNOT00000003739 MI0003489 rno-miR-1 UGGAAUGUAAAGAAGUGUGUAU
ENSRNOT00000003739 MI0000889 rno-miR-106b UAAAGUGCUGACAGUGCAGAU
ENSRNOT00000003739 MI0000891 rno-miR-122 UGGAGUGUGACAAUGGUGUUUG
ENSRNOT00000003739 MI0006131 rno-miR-17 CAAAGUGCUUACAGUGCAGGUAG
ENSRNOT00000003739 MI0000849 rno-miR-19a UGUGCAAAUCUAUGCAAAACUGA
ENSRNOT00000003739 MI0000847 rno-miR-19b UGUGCAAAUCCAUGCAAAACUGA
ENSRNOT00000003739 MI0000848 rno-miR-19b UGUGCAAAUCCAUGCAAAACUGA
ENSRNOT00000003739 MI0000948 rno-miR-206 UGGAAUGUAAGGAAGUGUGUGG
ENSRNOT00000003739 MI0000949 rno-miR-208 AUAAGACGAGCAAAAAGCUUGU
ENSRNOT00000003739 MI0000638 rno-miR-20a UAAAGUGCUUAUAGUGCAGGUAG
ENSRNOT00000003739 MI0003554 rno-miR-20b-5p CAAAGUGCUCAUAGUGCAGGU
ENSRNOT00000003739 MI0000960 rno-miR-219-2-3p AGAAUUGUGGCUGGACAUCUGU
ENSRNOT00000003739 MI0000852 rno-miR-23a AUCACAUUGCCAGGGAUUUCC
ENSRNOT00000003739 MI0000853 rno-miR-23b AUCACAUUGCCAGGGAUUACC
ENSRNOT00000003739 MI0000593 rno-miR-301a CAGUGCAAUAGUAUUGUCAAAGC
ENSRNOT00000003739 MI0006137 rno-miR-301b CAGUGCAAUGGUAUUGUCAAAGC
ENSRNOT00000003739 MI0001656 rno-miR-365 UAAUGCCCCUAAAAAUCCUUAU
ENSRNOT00000003739 MI0003545 rno-miR-376a* GGUAGAUUCUCCUUCUAUGAG
ENSRNOT00000003739 MI0006162 rno-miR-743a GAAAGACGCCAAACUGGGUAGA
ENSRNOT00000003739 MI0006115 rno-miR-743b GAAAGACACCAUACUGAAUAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Taketani S, et al. (2003) "Involvement of ABC7 in the biosynthesis of heme in erythroid cells: interaction of ABC7 with ferrochelatase." Blood. 101(8):3274-3280. PMID:12480705