Aamp | GeneID:301512 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 301512 Official Symbol Aamp
Locus N/A Gene Type protein-coding
Synonyms
Full Name angio-associated, migratory cell protein
Description angio-associated, migratory cell protein
Chromosome 9q33
Also Known As angio-associated migratory protein
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 846

ID Symbol Protein Species
GeneID:14 AAMP NP_001078.2 Homo sapiens
GeneID:39624 CG5114 NP_648731.1 Drosophila melanogaster
GeneID:176680 Y111B2A.12 NP_499643.1 Caenorhabditis elegans
GeneID:227290 Aamp NP_666222.2 Mus musculus
GeneID:301512 Aamp XP_217441.4 Rattus norvegicus
GeneID:405874 zgc:85939 NP_998103.1 Danio rerio
GeneID:459940 AAMP XP_001154321.1 Pan troglodytes
GeneID:478908 AAMP NP_001013872.1 Canis lupus familiaris
GeneID:767919 AAMP NP_001070463.1 Bos taurus
GeneID:769880 AAMP XP_001233195.1 Gallus gallus
GeneID:843514 AT1G71840 NP_177329.2 Arabidopsis thaliana
GeneID:1268314 ENSANGG00000011272 XP_306869.2 Anopheles gambiae
GeneID:1278314 AgaP_AGAP011387 XP_317937.2 Anopheles gambiae
GeneID:2542715 SPAC25H1.08c NP_593812.1 Schizosaccharomyces pombe
GeneID:4333750 Os03g0685600 NP_001050927.1 Oryza sativa

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0009986 Component cell surface
GO:0014909 Process smooth muscle cell migration

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001106920  UCSC Browser NP_001100390
2 XM_001057423  UCSC Browser XP_001057423
3 XM_217441  UCSC Browser XP_217441

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000019497 MI0003180 hsa-miR-516a-5p UUCUCGAGGAAAGAAGCACUUUC
ENSRNOT00000019497 MI0003181 hsa-miR-516a-5p UUCUCGAGGAAAGAAGCACUUUC
ENSRNOT00000019497 MI0003170 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENSRNOT00000019497 MI0003173 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENSRNOT00000019497 MI0003164 hsa-miR-520d-5p CUACAAAGGGAAGCCCUUUC
ENSRNOT00000019497 MI0003160 hsa-miR-524-3p GAAGGCGCUUCCCUUUGGAGU
ENSRNOT00000019497 MI0003160 hsa-miR-524-5p CUACAAAGGGAAGCACUUUCUC
ENSRNOT00000019497 MI0003152 hsa-miR-525-3p GAAGGCGCUUCCCUUUAGAGCG
ENSRNOT00000019497 MI0003590 hsa-miR-583 CAAAGAGGAAGGUCCCAUUAC
ENSRNOT00000019497 MI0003605 hsa-miR-593 UGUCUCUGCUGGGGUUUCU
ENSRNOT00000019497 MI0003641 hsa-miR-627 GUGAGUCUCUAAGAAAAGAGGA
ENSRNOT00000019497 MI0003650 hsa-miR-635 ACUUGGGCACUGAAACAAUGUCC
ENSRNOT00000019497 MI0003657 hsa-miR-642 GUCCCUCUCCAAAUGUGUCUUG
ENSRNOT00000019497 MI0003682 hsa-miR-658 GGCGGAGGGAAGUAGGUCCGUUGGU
ENSRNOT00000019497 MI0005562 hsa-miR-887 GUGAACGGGCGCCAUCCCGAGG
ENSRNOT00000019497 MI0005540 hsa-miR-889 UUAAUAUCGGACAACCAUUGU
ENSRNOT00000019497 MI0005715 hsa-miR-923 GUCAGCGGAGGAAAAGAAACU
ENSRNOT00000019497 MI0005004 mmu-miR-615-5p GGGGGUCCCCGGUGCUCGGAUC
ENSRNOT00000019497 MI0004553 mmu-miR-666-3p GGCUGCAGCGUGAUCGCCUGCU
ENSRNOT00000019497 MI0004660 mmu-miR-692 AUCUCUUUGAGCGCCUCACUC
ENSRNOT00000019497 MI0004661 mmu-miR-692 AUCUCUUUGAGCGCCUCACUC
ENSRNOT00000019497 MI0004699 mmu-miR-714 CGACGAGGGCCGGUCGGUCGC
ENSRNOT00000019497 MI0004215 mmu-miR-762 GGGGCUGGGGCCGGGACAGAGC
ENSRNOT00000019497 MI0005551 mmu-miR-875-5p UAUACCUCAGUUUUAUCAGGUG
ENSRNOT00000019497 MI0000898 rno-miR-126 UCGUACCGUGAGUAAUAAUGCG
ENSRNOT00000019497 MI0000913 rno-miR-139-3p UGGAGACGCGGCCCUGUUGGAG
ENSRNOT00000019497 MI0000930 rno-miR-185 UGGAGAGAAAGGCAGUUCCUGA
ENSRNOT00000019497 MI0000936 rno-miR-193* UGGGUCUUUGCGGGCAAGAUGA
ENSRNOT00000019497 MI0000940 rno-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENSRNOT00000019497 MI0000941 rno-miR-199a-5p CCCAGUGUUCAGACUACCUGUUC
ENSRNOT00000019497 MI0000946 rno-miR-204 UUCCCUUUGUCAUCCUAUGCCU
ENSRNOT00000019497 MI0003479 rno-miR-207 GCUUCUCCUGGCUCUCCUCCCUU
ENSRNOT00000019497 MI0000951 rno-miR-211 UUCCCUUUGUCAUCCUUUGCCU
ENSRNOT00000019497 MI0000957 rno-miR-218* CAUGGUUCUGUCAAGCACCGCG
ENSRNOT00000019497 MI0000965 rno-miR-291a-5p CAUCAAAGUGGAGGCCCUCUCU
ENSRNOT00000019497 MI0000967 rno-miR-296 GAGGGUUGGGUGGAGGCUCUCC
ENSRNOT00000019497 MI0000970 rno-miR-299 UGGUUUACCGUCCCACAUACAU
ENSRNOT00000019497 MI0000971 rno-miR-300-3p UAUGCAAGGGCAAGCUCUCUUC
ENSRNOT00000019497 MI0000594 rno-miR-324-5p CGCAUCCCCUAGGGCAUUGGUGU
ENSRNOT00000019497 MI0000626 rno-miR-342-3p UCUCACACAGAAAUCGCACCCGU
ENSRNOT00000019497 MI0003546 rno-miR-381 UAUACAAGGGCAAGCUCUC
ENSRNOT00000019497 MI0003549 rno-miR-485 AGAGGCUGGCCGUGAUGAAUUC
ENSRNOT00000019497 MI0003720 rno-miR-505 GUCAACACUUGCUGGUUUCC
ENSRNOT00000019497 MI0006162 rno-miR-743a GAAAGACGCCAAACUGGGUAGA
ENSRNOT00000019497 MI0006164 rno-miR-760-5p CCCCUCAGGCCACCAGAGCCCG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932