Abca12 | GeneID:301482 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 301482 Official Symbol Abca12
Locus N/A Gene Type protein-coding
Synonyms
Full Name ATP-binding cassette, sub-family A (ABC1), member 12
Description ATP-binding cassette, sub-family A (ABC1), member 12
Chromosome 9q33
Also Known As
Summary N/A

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005575 Component cellular_component
GO:0005743 Component mitochondrial inner membrane
GO:0003674 Function molecular_function
GO:0008150 Process biological_process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_001054709  UCSC Browser XP_001054709
2 XM_237242  UCSC Browser XP_237242

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000036359 MI0003616 hsa-miR-603 CACACACUGCAAUUACUUUUGC
ENSRNOT00000036359 MI0003619 hsa-miR-606 AAACUACUGAAAAUCAAAGAU
ENSRNOT00000036359 MI0003627 hsa-miR-614 GAACGCCUGUUCUUGCCAGGUGG
ENSRNOT00000036359 MI0003649 hsa-miR-634 AACCAGCACCCCAACUUUGGAC
ENSRNOT00000036359 MI0000763 mmu-miR-362-3p AACACACCUGUUCAAGGAUUCA
ENSRNOT00000036359 MI0005554 mmu-miR-511 AUGCCUUUUGCUCUGCACUCA
ENSRNOT00000036359 MI0004634 mmu-miR-677 UUCAGUGAUGAUUAGCUUCUGA
ENSRNOT00000036359 MI0004249 mmu-miR-802 UCAGUAACAAAGAUUCAUCCUU
ENSRNOT00000036359 MI0000829 rno-let-7b* CUAUACAACCUACUGCCUUCCC
ENSRNOT00000036359 MI0000895 rno-miR-125a-5p UCCCUGAGACCCUUUAACCUGUGA
ENSRNOT00000036359 MI0000843 rno-miR-15b UAGCAGCACAUCAUGGUUUACA
ENSRNOT00000036359 MI0000844 rno-miR-16 UAGCAGCACGUAAAUAUUGGCG
ENSRNOT00000036359 MI0000925 rno-miR-181a AACAUUCAACGCUGUCGGUGAGU
ENSRNOT00000036359 MI0000953 rno-miR-181a AACAUUCAACGCUGUCGGUGAGU
ENSRNOT00000036359 MI0000926 rno-miR-181b AACAUUCAUUGCUGUCGGUGGGU
ENSRNOT00000036359 MI0000927 rno-miR-181b AACAUUCAUUGCUGUCGGUGGGU
ENSRNOT00000036359 MI0000924 rno-miR-181c AACAUUCAACCUGUCGGUGAGU
ENSRNOT00000036359 MI0006132 rno-miR-181d AACAUUCAUUGUUGUCGGUGGGU
ENSRNOT00000036359 MI0000939 rno-miR-195 UAGCAGCACAGAAAUAUUGGC
ENSRNOT00000036359 MI0000861 rno-miR-28* CACUAGAUUGUGAGCUCCUGGA
ENSRNOT00000036359 MI0000604 rno-miR-329 AACACACCCAGCUAACCUUUUU
ENSRNOT00000036359 MI0000618 rno-miR-338* AACAAUAUCCUGGUGCUGAGUG
ENSRNOT00000036359 MI0000633 rno-miR-346 UGUCUGCCUGAGUGCCUGCCUCU
ENSRNOT00000036359 MI0003487 rno-miR-377 AUCACACAAAGGCAACUUUUGG
ENSRNOT00000036359 MI0003724 rno-miR-497 CAGCAGCACACUGUGGUUUGUA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Lefevre C, et al. (2003) "Mutations in the transporter ABCA12 are associated with lamellar ichthyosis type 2." Hum Mol Genet. 12(18):2369-2378. PMID:12915478