Aars2 | GeneID:301254 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 301254 Official Symbol Aars2
Locus N/A Gene Type protein-coding
Synonyms Aarsl
Full Name alanyl-tRNA synthetase 2, mitochondrial (putative)
Description alanyl-tRNA synthetase 2, mitochondrial (putative)
Chromosome 9q12
Also Known As alanyl-tRNA synthetase like
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 56897

ID Symbol Protein Species
GeneID:57505 AARS2 NP_065796.1 Homo sapiens
GeneID:224805 Aars2 NP_941010.2 Mus musculus
GeneID:301254 Aars2 XP_236942.4 Rattus norvegicus
GeneID:421436 RCJMB04_28n18 NP_001026227.1 Gallus gallus
GeneID:462733 AARS2 XP_518510.2 Pan troglodytes
GeneID:474920 AARS2 XP_532155.2 Canis lupus familiaris
GeneID:786099 AARS2 XP_001253240.1 Bos taurus
GeneID:792787 si:dkey-240e12.1 XP_001332388.2 Danio rerio

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0004813 Function alanine-tRNA ligase activity
GO:0005524 Function ATP binding
GO:0003676 Function nucleic acid binding
GO:0000166 Function nucleotide binding
GO:0006419 Process alanyl-tRNA aminoacylation
GO:0006412 Process translation

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001106891  UCSC Browser NP_001100361
2 XM_001067517  UCSC Browser XP_001067517
3 XM_236942  UCSC Browser XP_236942

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000031549 MI0000780 hsa-miR-372 AAAGUGCUGCGACAUUUGAGCGU
ENSRNOT00000031549 MI0003145 hsa-miR-519e AAGUGCCUCCUUUUAGAGUGUU
ENSRNOT00000031549 MI0003164 hsa-miR-520d-3p AAAGUGCUUCUCUUUGGUGGGU
ENSRNOT00000031549 MI0003600 hsa-miR-550 AGUGCCUGAGGGAGUAAGAGCCC
ENSRNOT00000031549 MI0003601 hsa-miR-550 AGUGCCUGAGGGAGUAAGAGCCC
ENSRNOT00000031549 MI0003645 hsa-miR-631 AGACCUGGCCCAGACCUCAGC
ENSRNOT00000031549 MI0003683 hsa-miR-659 CUUGGUUCAGGGAGGGUCCCCA
ENSRNOT00000031549 MI0003836 hsa-miR-766 ACUCCAGCCCCACAGCCUCAGC
ENSRNOT00000031549 MI0005527 hsa-miR-886-3p CGCGGGUGCUUACUGACCCUU
ENSRNOT00000031549 MI0005481 mmu-miR-105 CCAAGUGCUCAGAUGCUUGUGGU
ENSRNOT00000031549 MI0000391 mmu-miR-293 AGUGCCGCAGAGUUUGUAGUGU
ENSRNOT00000031549 MI0000393 mmu-miR-295 AAAGUGCUACUACUUUUGAGUCU
ENSRNOT00000031549 MI0003717 mmu-miR-302c AAGUGCUUCCAUGUUUCAGUGG
ENSRNOT00000031549 MI0003718 mmu-miR-302d UAAGUGCUUCCAUGUUUGAGUGU
ENSRNOT00000031549 MI0002402 mmu-miR-467a UAAGUGCCUGCAUGUAUAUGCG
ENSRNOT00000031549 MI0004671 mmu-miR-467b GUAAGUGCCUGCAUGUAUAUG
ENSRNOT00000031549 MI0002404 mmu-miR-469 UGCCUCUUUCAUUGAUCUUGGUGUCC
ENSRNOT00000031549 MI0004680 mmu-miR-491 AGUGGGGAACCCUUCCAUGAGG
ENSRNOT00000031549 MI0005004 mmu-miR-615-3p UCCGAGCCUGGGUCUCCCUCUU
ENSRNOT00000031549 MI0005520 mmu-miR-654-3p UAUGUCUGCUGACCAUCACCUU
ENSRNOT00000031549 MI0004685 mmu-miR-701 UUAGCCGCUGAAAUAGAUGGA
ENSRNOT00000031549 MI0000601 rno-let-7d* CUAUACGACCUGCUGCCUUUCU
ENSRNOT00000031549 MI0000835 rno-let-7i* CUGCGCAAGCUACUGCCUUGCU
ENSRNOT00000031549 MI0000920 rno-miR-150 UCUCCCAACCCUUGUACCAGUG
ENSRNOT00000031549 MI0000936 rno-miR-193* UGGGUCUUUGCGGGCAAGAUGA
ENSRNOT00000031549 MI0000965 rno-miR-291a-3p AAAGUGCUUCCACUUUGUGUGCC
ENSRNOT00000031549 MI0000968 rno-miR-297 AUGUAUGUGUGCAUGUAUGCAUG
ENSRNOT00000031549 MI0000602 rno-miR-328 CUGGCCCUCUCUGCCCUUCCGU
ENSRNOT00000031549 MI0000631 rno-miR-345-5p UGCUGACCCCUAGUCCAGUGC
ENSRNOT00000031549 MI0006112 rno-miR-466b UAUGUGUGUGUGUAUGUCCAUG
ENSRNOT00000031549 MI0006113 rno-miR-466b UAUGUGUGUGUGUAUGUCCAUG
ENSRNOT00000031549 MI0006159 rno-miR-674-5p GCACUGAGAUGGGAGUGGUGUA
ENSRNOT00000031549 MI0006164 rno-miR-760-5p CCCCUCAGGCCACCAGAGCCCG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932