Aasdhppt | GeneID:300328 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 300328 Official Symbol Aasdhppt
Locus N/A Gene Type protein-coding
Synonyms
Full Name aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase
Description aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase
Chromosome 8q11
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 9130

ID Symbol Protein Species
GeneID:60496 AASDHPPT NP_056238.2 Homo sapiens
GeneID:67618 Aasdhppt NP_080552.2 Mus musculus
GeneID:180425 T04G9.4 NP_508153.1 Caenorhabditis elegans
GeneID:189061 T28H10.1 NP_506135.1 Caenorhabditis elegans
GeneID:300328 Aasdhppt XP_217078.3 Rattus norvegicus
GeneID:317852 eap NP_729788.1 Drosophila melanogaster
GeneID:418975 AASDHPPT XP_417169.2 Gallus gallus
GeneID:451524 AASDHPPT XP_508734.2 Pan troglodytes
GeneID:489426 AASDHPPT XP_546544.2 Canis lupus familiaris
GeneID:519816 AASDHPPT XP_869172.1 Bos taurus
GeneID:619247 zgc:114148 NP_001028901.1 Danio rerio
GeneID:784811 AASDHPPT XP_001250766.1 Bos taurus
GeneID:4349713 Os11g0136500 NP_001065690.1 Oryza sativa
GeneID:4351429 Os12g0133400 NP_001066088.1 Oryza sativa

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005829 Component cytosol
GO:0008897 Function holo-[acyl-carrier-protein] synthase activity
GO:0000287 Function magnesium ion binding
GO:0016740 Function transferase activity
GO:0009059 Process macromolecule biosynthetic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001106798  UCSC Browser NP_001100268
2 XM_001070860  UCSC Browser XP_001070860
3 XM_217078  UCSC Browser XP_217078

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000008062 MI0003614 hsa-miR-601 UGGUCUAGGAUUGUUGGAGGAG
ENSRNOT00000008062 MI0003648 hsa-miR-633 CUAAUAGUAUCUACCACAAUAAA
ENSRNOT00000008062 MI0003659 hsa-miR-644 AGUGUGGCUUUCUUAGAGC
ENSRNOT00000008062 MI0003677 hsa-miR-655 AUAAUACAUGGUUAACCUCUUU
ENSRNOT00000008062 MI0003683 hsa-miR-659 CUUGGUUCAGGGAGGGUCCCCA
ENSRNOT00000008062 MI0005116 hsa-miR-765 UGGAGGAGAAGGAAGGUGAUG
ENSRNOT00000008062 MI0005533 hsa-miR-890 UACUUGGAAAGGCAUCAGUUG
ENSRNOT00000008062 MI0005755 hsa-miR-933 UGUGCGCAGGGAGACCUCUCCC
ENSRNOT00000008062 MI0001734 mmu-miR-452 UGUUUGCAGAGGAAACUGAGAC
ENSRNOT00000008062 MI0005002 mmu-miR-490 CAACCUGGAGGACUCCAUGCUG
ENSRNOT00000008062 MI0004680 mmu-miR-491 AGUGGGGAACCCUUCCAUGAGG
ENSRNOT00000008062 MI0004634 mmu-miR-677 UUCAGUGAUGAUUAGCUUCUGA
ENSRNOT00000008062 MI0004644 mmu-miR-682 CUGCAGUCACAGUGAAGUCUG
ENSRNOT00000008062 MI0004658 mmu-miR-690 AAAGGCUAGGCUCACAACCAAA
ENSRNOT00000008062 MI0004688 mmu-miR-704 AGACAUGUGCUCUGCUCCUAG
ENSRNOT00000008062 MI0004689 mmu-miR-705 GGUGGGAGGUGGGGUGGGCA
ENSRNOT00000008062 MI0005475 mmu-miR-882 AGGAGAGAGUUAGCGCAUUAGU
ENSRNOT00000008062 MI0000829 rno-let-7b* CUAUACAACCUACUGCCUUCCC
ENSRNOT00000008062 MI0000601 rno-let-7d* CUAUACGACCUGCUGCCUUUCU
ENSRNOT00000008062 MI0000835 rno-let-7i* CUGCGCAAGCUACUGCCUUGCU
ENSRNOT00000008062 MI0000917 rno-miR-144 UACAGUAUAGAUGAUGUACU
ENSRNOT00000008062 MI0000953 rno-miR-181a* ACCAUCGACCGUUGAUUGUACC
ENSRNOT00000008062 MI0000940 rno-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENSRNOT00000008062 MI0000851 rno-miR-22 AAGCUGCCAGUUGAAGAACUGU
ENSRNOT00000008062 MI0000852 rno-miR-23a* GGGGUUCCUGGGGAUGGGAUUU
ENSRNOT00000008062 MI0000868 rno-miR-30b-3p CUGGGAUGUGGAUGUUUACGUC
ENSRNOT00000008062 MI0000867 rno-miR-30e* CUUUCAGUCGGAUGUUUACAGC
ENSRNOT00000008062 MI0000876 rno-miR-34c* AAUCACUAACCACACAGCCAGG
ENSRNOT00000008062 MI0003545 rno-miR-376a AUCGUAGAGGAAAAUCCACGU
ENSRNOT00000008062 MI0003544 rno-miR-376b-3p AUCAUAGAGGAACAUCCACUU
ENSRNOT00000008062 MI0001722 rno-miR-431 UGUCUUGCAGGCCGUCAUGCA
ENSRNOT00000008062 MI0006147 rno-miR-434 UUUGAACCAUCACUCGACUCCU
ENSRNOT00000008062 MI0006160 rno-miR-708* CAACUAGACUGUGAGCUUCUAG
ENSRNOT00000008062 MI0006121 rno-miR-879 AGAGGCUUAUAGCUCUAAGCC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932