Aaas | GeneID:300259 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 300259 Official Symbol Aaas
Locus N/A Gene Type protein-coding
Synonyms
Full Name achalasia, adrenocortical insufficiency, alacrimia (Allgrove, triple-A)
Description achalasia, adrenocortical insufficiency, alacrimia (Allgrove, triple-A)
Chromosome 7q36
Also Known As
Summary N/A

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005575 Component cellular_component
GO:0005643 Component nuclear pore
GO:0003674 Function molecular_function
GO:0008150 Process biological_process
GO:0009566 Process fertilization
GO:0007612 Process learning

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001106795  UCSC Browser NP_001100265
2 XM_001067255  UCSC Browser XP_001067255
3 XM_217063  UCSC Browser XP_217063

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000018809 MI0003820 hsa-miR-454 UAGUGCAAUAUUGCUUAUAGGGU
ENSRNOT00000018809 MI0003599 hsa-miR-589 UGAGAACCACGUCUGCUCUGAG
ENSRNOT00000018809 MI0003672 hsa-miR-663 AGGCGGGGCGCCGCGGGACCGC
ENSRNOT00000018809 MI0003836 hsa-miR-766 ACUCCAGCCCCACAGCCUCAGC
ENSRNOT00000018809 MI0003834 hsa-miR-769-3p CUGGGAUCUCCGGGGUCUUGGUU
ENSRNOT00000018809 MI0000763 mmu-miR-362-3p AACACACCUGUUCAAGGAUUCA
ENSRNOT00000018809 MI0005497 mmu-miR-453 AGGUUGCCUCAUAGUGAGCUUGCA
ENSRNOT00000018809 MI0005002 mmu-miR-490 CAACCUGGAGGACUCCAUGCUG
ENSRNOT00000018809 MI0005519 mmu-miR-590-5p GAGCUUAUUCAUAAAAGUGCAG
ENSRNOT00000018809 MI0004171 mmu-miR-665 ACCAGGAGGCUGAGGUCCCU
ENSRNOT00000018809 MI0004681 mmu-miR-697 AACAUCCUGGUCCUGUGGAGA
ENSRNOT00000018809 MI0004700 mmu-miR-715 CUCCGUGCACACCCCCGCGUG
ENSRNOT00000018809 MI0000903 rno-miR-130a CAGUGCAAUGUUAAAAGGGCAU
ENSRNOT00000018809 MI0000904 rno-miR-130b CAGUGCAAUGAUGAAAGGGCAU
ENSRNOT00000018809 MI0000918 rno-miR-145 GUCCAGUUUUCCCAGGAAUCCCU
ENSRNOT00000018809 MI0000919 rno-miR-146a UGAGAACUGAAUUCCAUGGGUU
ENSRNOT00000018809 MI0000850 rno-miR-21 UAGCUUAUCAGACUGAUGUUGA
ENSRNOT00000018809 MI0000866 rno-miR-30c-1* CUGGGAGAGGGUUGUUUACUCC
ENSRNOT00000018809 MI0000871 rno-miR-30c-2* CUGGGAGAAGGCUGUUUACUCU
ENSRNOT00000018809 MI0000622 rno-miR-340-3p UCCGUCUCAGUUACUUUAUAGCC
ENSRNOT00000018809 MI0000631 rno-miR-345-3p CCCUGAACUAGGGGUCUGGAGA
ENSRNOT00000018809 MI0000631 rno-miR-345-5p UGCUGACCCCUAGUCCAGUGC
ENSRNOT00000018809 MI0003525 rno-miR-543 AAGUUGCCCGCGUGUUUUUCGC
ENSRNOT00000018809 MI0006156 rno-miR-671 UCCGGUUCUCAGGGCUCCACC
ENSRNOT00000018809 MI0006165 rno-miR-770 AGCACCACGUGUCUGGGCCACG
ENSRNOT00000018809 MI0006117 rno-miR-872* UGAACUAUUGCAGUAGCCUCCU
ENSRNOT00000018809 MI0006118 rno-miR-874 CUGCCCUGGCCCGAGGGACCGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Storr HL, et al. (2005) "Identification of the sites of expression of triple A syndrome mRNA in the rat using in situ hybridisation." Neuroscience. 131(1):113-123. PMID:15680696
  2. [ + ] Brooks BP, et al. (2005) "Genotypic heterogeneity and clinical phenotype in triple A syndrome: a review of the NIH experience 2000-2005." Clin Genet. 68(3):215-221. PMID:16098009