ACAA1 | GeneID:30 | Homo sapiens
Gene Summary
[
] NCBI Entrez Gene
| Gene ID | 30 | Official Symbol | ACAA1 |
|---|---|---|---|
| Locus | N/A | Gene Type | protein-coding |
| Synonyms | ACAA; PTHIO; THIO | ||
| Full Name | acetyl-Coenzyme A acyltransferase 1 | ||
| Description | acetyl-Coenzyme A acyltransferase 1 | ||
| Chromosome | 3p23-p22 | ||
| Also Known As | peroxisomal 3-oxoacyl-Coenzyme A thiolase | ||
| Summary | This gene encodes an enzyme operative in the beta-oxidation system of the peroxisomes. Deficiency of this enzyme leads to pseudo-Zellweger syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq] | ||
Orthologs and Paralogs
[
] Homologs - NCBI's HomoloGene Group: 37497
| ID | Symbol | Protein | Species |
|---|---|---|---|
| GeneID:30 | ACAA1 | NP_001598.1 | Homo sapiens |
| GeneID:24157 | Acaa1 | NP_036621.1 | Rattus norvegicus |
| GeneID:113868 | Acaa1a | NP_570934.1 | Mus musculus |
| GeneID:460268 | ACAA1 | XP_001171323.1 | Pan troglodytes |
| GeneID:477023 | ACAA1 | XP_534222.2 | Canis lupus familiaris |
| GeneID:501072 | RGD1562373 | XP_001062085.1 | Rattus norvegicus |
| GeneID:508324 | ACAA1 | NP_001029491.1 | Bos taurus |
| GeneID:770094 | ACAA1 | XP_001232577.1 | Gallus gallus |
| GeneID:817876 | KAT2/PED1 | NP_180873.1 | Arabidopsis thaliana |
| GeneID:839434 | AT1G04710 | NP_171965.1 | Arabidopsis thaliana |
| GeneID:2682904 | MGG_10700 | XP_367070.1 | Magnaporthe grisea |
| GeneID:2712196 | NCU09646.1 | XP_330296.1 | Neurospora crassa |
| GeneID:4331150 | Os02g0817700 | NP_001048523.1 | Oryza sativa |
Gene Classification
[
] Gene Ontology
| ID | Category | GO Term |
|---|---|---|
| GO:0005737 | Component | cytoplasm |
| GO:0043231 | Component | intracellular membrane-bounded organelle |
| GO:0005777 | Component | peroxisome |
| GO:0003988 | Function | acetyl-CoA C-acyltransferase activity |
| GO:0008415 | Function | acyltransferase activity |
| GO:0005515 | Function | protein binding |
| GO:0016740 | Function | transferase activity |
| GO:0006631 | Process | fatty acid metabolic process |
| GO:0006091 | Process | generation of precursor metabolites and energy |
| GO:0006629 | Process | lipid metabolic process |
| GO:0008152 | Process | metabolic process |
RefSeq Isoforms
[
] RefSeq Annotation and UniProt Database
| No. | RefSeq RNA | RefSeq Protein | UniProt Equivalent |
|---|---|---|---|
| 1 | NM_001130410 UCSC Browser | NP_001123882 | |
| 2 | NM_001607 UCSC Browser | NP_001598 | |
| 3 | NR_024024 UCSC Browser | ||
MicroRNA and Targets
[
] MicroRNA Sequences and Transcript Targets from miRBase at Sanger
| RNA Target | miRNA # | mat miRNA | Mature miRNA Sequence |
|---|---|---|---|
| ENST00000333167 | MI0000064 | hsa-let-7c* | UAGAGUUACACCCUGGGAGUUA |
| ENST00000333167 | MI0000443 | hsa-miR-124* | CGUGUUCACAGCGGACCUUGAU |
| ENST00000333167 | MI0000444 | hsa-miR-124* | CGUGUUCACAGCGGACCUUGAU |
| ENST00000333167 | MI0000445 | hsa-miR-124* | CGUGUUCACAGCGGACCUUGAU |
| ENST00000333167 | MI0000448 | hsa-miR-130a* | UUCACAUUGUGCUACUGUCUGC |
| ENST00000333167 | MI0000449 | hsa-miR-132* | ACCGUGGCUUUCGAUUGUUACU |
| ENST00000333167 | MI0000452 | hsa-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA |
| ENST00000333167 | MI0000453 | hsa-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA |
| ENST00000333167 | MI0000810 | hsa-miR-135b | UAUGGCUUUUCAUUCCUAUGUGA |
| ENST00000333167 | MI0000458 | hsa-miR-142-3p | UGUAGUGUUUCCUACUUUAUGGA |
| ENST00000333167 | MI0000262 | hsa-miR-147 | GUGUGUGGAAAUGCUUCUGC |
| ENST00000333167 | MI0000463 | hsa-miR-153 | UUGCAUAGUCACAAAAGUGAUC |
| ENST00000333167 | MI0000464 | hsa-miR-153 | UUGCAUAGUCACAAAAGUGAUC |
| ENST00000333167 | MI0000069 | hsa-miR-15a | UAGCAGCACAUAAUGGUUUGUG |
| ENST00000333167 | MI0000438 | hsa-miR-15b | UAGCAGCACAUCAUGGUUUACA |
| ENST00000333167 | MI0000070 | hsa-miR-16 | UAGCAGCACGUAAAUAUUGGCG |
| ENST00000333167 | MI0000115 | hsa-miR-16 | UAGCAGCACGUAAAUAUUGGCG |
| ENST00000333167 | MI0000271 | hsa-miR-181c* | AACCAUCGACCGUUGAGUGGAC |
| ENST00000333167 | MI0000239 | hsa-miR-197 | UUCACCACCUUCUCCACCCAGC |
| ENST00000333167 | MI0000242 | hsa-miR-199a-5p | CCCAGUGUUCAGACUACCUGUUC |
| ENST00000333167 | MI0000281 | hsa-miR-199a-5p | CCCAGUGUUCAGACUACCUGUUC |
| ENST00000333167 | MI0000282 | hsa-miR-199b-5p | CCCAGUGUUUAGACUAUCUGUUC |
| ENST00000333167 | MI0000073 | hsa-miR-19a* | AGUUUUGCAUAGUUGCACUACA |
| ENST00000333167 | MI0000074 | hsa-miR-19b-1* | AGUUUUGCAGGUUUGCAUCCAGC |
| ENST00000333167 | MI0000075 | hsa-miR-19b-2* | AGUUUUGCAGGUUUGCAUUUCA |
| ENST00000333167 | MI0003130 | hsa-miR-202* | UUCCUAUGCAUAUACUUCUUUG |
| ENST00000333167 | MI0000077 | hsa-miR-21* | CAACACCAGUCGAUGGGCUGU |
| ENST00000333167 | MI0000290 | hsa-miR-214 | ACAGCAGGCACAGACAGGCAGU |
| ENST00000333167 | MI0000296 | hsa-miR-219-1-3p | AGAGUUGAGUCUGGACGUCCCG |
| ENST00000333167 | MI0005529 | hsa-miR-220b | CCACCACCGUGUCUGACACUU |
| ENST00000333167 | MI0000079 | hsa-miR-23a | AUCACAUUGCCAGGGAUUUCC |
| ENST00000333167 | MI0000439 | hsa-miR-23b | AUCACAUUGCCAGGGAUUACC |
| ENST00000333167 | MI0000082 | hsa-miR-25 | CAUUGCACUUGUCUCGGUCUGA |
| ENST00000333167 | MI0000738 | hsa-miR-302a | UAAGUGCUUCCAUGUUUUGGUGA |
| ENST00000333167 | MI0000772 | hsa-miR-302b | UAAGUGCUUCCAUGUUUUAGUAG |
| ENST00000333167 | MI0000773 | hsa-miR-302c | UAAGUGCUUCCAUGUUUCAGUGG |
| ENST00000333167 | MI0000774 | hsa-miR-302d | UAAGUGCUUCCAUGUUUGAGUGU |
| ENST00000333167 | MI0000089 | hsa-miR-31* | UGCUAUGCCAACAUAUUGCCAU |
| ENST00000333167 | MI0000090 | hsa-miR-32 | UAUUGCACAUUACUAAGUUGCA |
| ENST00000333167 | MI0000806 | hsa-miR-337-3p | CUCCUAUAUGAUGCCUUUCUUC |
| ENST00000333167 | MI0000815 | hsa-miR-339-3p | UGAGCGCCUCGACGACAGAGCCG |
| ENST00000333167 | MI0003646 | hsa-miR-33b | GUGCAUUGCUGUUGCAUUGC |
| ENST00000333167 | MI0003646 | hsa-miR-33b* | CAGUGCCUCGGCAGUGCAGCCC |
| ENST00000333167 | MI0000764 | hsa-miR-363 | AAUUGCACGGUAUCCAUCUGUA |
| ENST00000333167 | MI0000767 | hsa-miR-365 | UAAUGCCCCUAAAAAUCCUUAU |
| ENST00000333167 | MI0000769 | hsa-miR-365 | UAAUGCCCCUAAAAAUCCUUAU |
| ENST00000333167 | MI0000775 | hsa-miR-367 | AAUUGCACUUUAGCAAUGGUGA |
| ENST00000333167 | MI0000779 | hsa-miR-371-3p | AAGUGCCGCCAUCUUUUGAGUGU |
| ENST00000333167 | MI0000781 | hsa-miR-373 | GAAGUGCUUCGAUUUUGGGGUGU |
| ENST00000333167 | MI0001735 | hsa-miR-409-5p | AGGUUACCCGAGCAACUUUGCAU |
| ENST00000333167 | MI0002464 | hsa-miR-412 | ACUUCACCUGGUCCACUAGCCGU |
| ENST00000333167 | MI0001721 | hsa-miR-431 | UGUCUUGCAGGCCGUCAUGCA |
| ENST00000333167 | MI0001729 | hsa-miR-451 | AAACCGUUACCAUUACUGAGUU |
| ENST00000333167 | MI0001733 | hsa-miR-452 | AACUGUUUGCAGAGGAAACUGA |
| ENST00000333167 | MI0002467 | hsa-miR-483-3p | UCACUCCUCUCCUCCCGUCUU |
| ENST00000333167 | MI0002470 | hsa-miR-486-5p | UCCUGUACUGAGCUGCCCCGAG |
| ENST00000333167 | MI0003125 | hsa-miR-490-5p | CCAUGGAUCUCCAGGUGGGU |
| ENST00000333167 | MI0003138 | hsa-miR-497 | CAGCAGCACACUGUGGUUUGU |
| ENST00000333167 | MI0003188 | hsa-miR-503 | UAGCAGCGGGAACAGUUCUGCAG |
| ENST00000333167 | MI0003190 | hsa-miR-505 | CGUCAACACUUGCUGGUUUCCU |
| ENST00000333167 | MI0003194 | hsa-miR-507 | UUUUGCACCUUUUGGAGUGAA |
| ENST00000333167 | MI0003140 | hsa-miR-512-3p | AAGUGCUGUCAUAGCUGAGGUC |
| ENST00000333167 | MI0003141 | hsa-miR-512-3p | AAGUGCUGUCAUAGCUGAGGUC |
| ENST00000333167 | MI0003144 | hsa-miR-515-3p | GAGUGCCUUCUUUUGGAGCGUU |
| ENST00000333167 | MI0003147 | hsa-miR-515-3p | GAGUGCCUUCUUUUGGAGCGUU |
| ENST00000333167 | MI0003161 | hsa-miR-517a | AUCGUGCAUCCCUUUAGAGUGU |
| ENST00000333167 | MI0003174 | hsa-miR-517c | AUCGUGCAUCCUUUUAGAGUGU |
| ENST00000333167 | MI0003171 | hsa-miR-518d-5p | CUCUAGAGGGAAGCACUUUCUG |
| ENST00000333167 | MI0003169 | hsa-miR-518e | AAAGCGCUUCCCUUCAGAGUG |
| ENST00000333167 | MI0003169 | hsa-miR-518e* | CUCUAGAGGGAAGCGCUUUCUG |
| ENST00000333167 | MI0003154 | hsa-miR-518f* | CUCUAGAGGGAAGCACUUUCUC |
| ENST00000333167 | MI0003145 | hsa-miR-519e | AAGUGCCUCCUUUUAGAGUGUU |
| ENST00000333167 | MI0003149 | hsa-miR-520a-3p | AAAGUGCUUCCCUUUGGACUGU |
| ENST00000333167 | MI0003164 | hsa-miR-520d-3p | AAAGUGCUUCUCUUUGGUGGGU |
| ENST00000333167 | MI0003205 | hsa-miR-532-5p | CAUGCCUUGAGUGUAGGACCGU |
| ENST00000333167 | MI0003556 | hsa-miR-551a | GCGACCCACUCUUGGUUUCCA |
| ENST00000333167 | MI0003575 | hsa-miR-551b | GCGACCCAUACUUGGUUUCAG |
| ENST00000333167 | MI0003563 | hsa-miR-557 | GUUUGCACGGGUGGGCCUUGUCU |
| ENST00000333167 | MI0003572 | hsa-miR-566 | GGGCGCCUGUGAUCCCAAC |
| ENST00000333167 | MI0003580 | hsa-miR-573 | CUGAAGUGAUGUGUAACUGAUCAG |
| ENST00000333167 | MI0003603 | hsa-miR-591 | AGACCAUGGGUUCUCAUUGU |
| ENST00000333167 | MI0003623 | hsa-miR-610 | UGAGCUAAAUGUGUGCUGGGA |
| ENST00000333167 | MI0003647 | hsa-miR-632 | GUGUCUGCUUCCUGUGGGA |
| ENST00000333167 | MI0003654 | hsa-miR-639 | AUCGCUGCGGUUGCGAGCGCUGU |
| ENST00000333167 | MI0003655 | hsa-miR-640 | AUGAUCCAGGAACCUGCCUCU |
| ENST00000333167 | MI0003658 | hsa-miR-643 | ACUUGUAUGCUAGCUCAGGUAG |
| ENST00000333167 | MI0003676 | hsa-miR-654-3p | UAUGUCUGCUGACCAUCACCUU |
| ENST00000333167 | MI0003684 | hsa-miR-660 | UACCCAUUGCAUAUCGGAGUUG |
| ENST00000333167 | MI0003669 | hsa-miR-661 | UGCCUGGGUCUCUGGCCUGCGCGU |
| ENST00000333167 | MI0003836 | hsa-miR-766 | ACUCCAGCCCCACAGCCUCAGC |
| ENST00000333167 | MI0005542 | hsa-miR-876-3p | UGGUGGUUUACAAAGUAAUUCA |
| ENST00000333167 | MI0005528 | hsa-miR-892a | CACUGUGUCCUUUCUGCGUAG |
| ENST00000333167 | MI0000093 | hsa-miR-92a | UAUUGCACUUGUCCCGGCCUGU |
| ENST00000333167 | MI0000094 | hsa-miR-92a | UAUUGCACUUGUCCCGGCCUGU |
| ENST00000333167 | MI0003560 | hsa-miR-92b | UAUUGCACUCGUCCCGGCCUCC |
| ENST00000333167 | MI0005756 | hsa-miR-934 | UGUCUACUACUGGAGACACUGG |
| ENST00000333167 | MI0005768 | hsa-miR-943 | CUGACUGUUGCCGUCCUCCAG |
| ENST00000333167 | MI0000098 | hsa-miR-96* | AAUCAUGUGCAGUGCCAAUAUG |
| ENST00000333167 | MI0000388 | mmu-miR-290-3p | AAAGUGCCGCCUAGUUUUAAGCCC |
| ENST00000333167 | MI0000389 | mmu-miR-291a-3p | AAAGUGCUUCCACUUUGUGUGC |
| ENST00000333167 | MI0000390 | mmu-miR-292-3p | AAAGUGCCGCCAGGUUUUGAGUGU |
| ENST00000333167 | MI0002402 | mmu-miR-467a | UAAGUGCCUGCAUGUAUAUGCG |
| ENST00000333167 | MI0004647 | mmu-miR-684 | AGUUUUCCCUUCAAGUCAA |
| ENST00000333167 | MI0004648 | mmu-miR-684 | AGUUUUCCCUUCAAGUCAA |
| ENST00000333167 | MI0004306 | mmu-miR-761 | GCAGCAGGGUGAAACUGACACA |
| ENST00000333167 | MI0005204 | mmu-miR-805 | GAAUUGAUCAGGACAUAGGG |
| ENST00000333167 | MI0005473 | mmu-miR-880 | UACUCCAUCCUCUCUGAGUAGA |
| ENST00000333167 | MI0000644 | rno-miR-352 | AGAGUAGUAGGUUGCAUAGUA |
Transcript Sequences
[
] Transcript Accession Number Cloud [ GenBank ]
AF035295 AK025138 AK127051 AK293716 AK301056 AK303251 AK316551 BC000635 BC011977 BC014474 BC025780 BC039837 CR591578 CR594169 CR595862 CR598152 CR600577 CR603602 CR605477 CR607199 CR607231 CR608061 CR609571 CR610044 CR610125 CR612027 CR612253 CR612814 CR613357 CR618847 CR625217 CR625245 CR626439 CR626521 DC312566 DC379687 DQ891298 DQ893346 DQ894482 NM_001130410 NM_001607 NR_024024 X12966 X14813 X51460
Chemicals and Drugs
[
] Comparative Toxicogenomics Database from MDI Biological Lab
Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
| Chemical and Interaction | |
|---|---|
| Cadmium | |
|
|
| Cadmium Chloride | |
|
|
| Dietary Fats | |
|
|
| furan | |
|
|
| Hydralazine | |
|
|
| Methapyrilene | |
|
|
| Methotrexate | |
|
|
| perfluorooctane sulfonic acid | |
|
|
| perfluorooctanoic acid | |
|
|
| Phthalic Acids | |
|
|
| pirinixic acid | |
|
|
| pirinixic acid | |
|
|
| Tetrachlorodibenzodioxin | |
|
|
| Valproic Acid | |
|
|
Gene and Diseases
[
] Gene and Diseases [Data source: CTD]
Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
| Disease Name | Relationship | PubMed |
|---|---|---|
| D-BIFUNCTIONAL PROTEIN DEFICIENCY | marker | |
| Dystonia | inferred via Valproic Acid | 1851702 |
| Fatty Liver | inferred via Valproic Acid | 14986274 |
| Leukemia, Myeloid, Acute | inferred via Valproic Acid | 16294345 |
| Migraine Disorders | inferred via Valproic Acid | 18765137, 18803445 |
| Pseudolymphoma | inferred via Valproic Acid | 12752131 |
| Seizures | inferred via Valproic Acid | 11738929 |
| Unverricht-Lundborg Syndrome | inferred via Valproic Acid | 3119515 |
| Adenoma, Liver Cell | inferred via Tetrachlorodibenzodioxin | 16835633 |
| Carcinoma | inferred via Tetrachlorodibenzodioxin | 16835633 |
| Cholangiocarcinoma | inferred via Tetrachlorodibenzodioxin | 16835633 |
| Cleft Palate | inferred via Tetrachlorodibenzodioxin | 8697196 |
| Diabetes Mellitus, Type 2 | inferred via Tetrachlorodibenzodioxin | 17107852 |
| Hydronephrosis | inferred via Tetrachlorodibenzodioxin | 8697196 |
| Liver Neoplasms | inferred via Tetrachlorodibenzodioxin | 16984957 |
| Edema | inferred via pirinixic acid | 12083418 |
| Liver Neoplasms | inferred via pirinixic acid | 15890375 |
| Edema | inferred via perfluorooctanoic acid | 17259670, 12083418 |
| Hepatomegaly | inferred via perfluorooctanoic acid | 3609246 |
| Hyperalgesia | inferred via perfluorooctanoic acid | 12083418 |
| Inflammation | inferred via perfluorooctanoic acid | 12083418 |
| Leydig Cell Tumor | inferred via perfluorooctanoic acid | 8812269 |
| Liver Neoplasms | inferred via perfluorooctanoic acid | 14757943 |
| Niemann-Pick Disease, Type C | inferred via perfluorooctanoic acid | 9802331 |
| Prenatal Exposure Delayed Effects | inferred via perfluorooctanoic acid | 17132714 |
| Glioblastoma | inferred via perfluorooctane sulfonic acid | 17162496 |
| Arthritis, Rheumatoid | inferred via Methotrexate | 17286800 |
| Breast Neoplasms | inferred via Methotrexate | 16978400 |
| Graft vs Host Disease | inferred via Methotrexate | 16518429 |
| Liver Cirrhosis | inferred via Methotrexate | 14986274 |
| Mucositis | inferred via Methotrexate | 17488658 |
| Psoriasis | inferred via Methotrexate | 17410198 |
| Liver Neoplasms | inferred via Methapyrilene | 15890375 |
| Hypertension, Pregnancy-Induced | inferred via Hydralazine | 16612254 |
| Arteriosclerosis | inferred via Dietary Fats | 15238619 |
| Dyslipidemias | inferred via Dietary Fats | 18367378 |
| Insulin Resistance | inferred via Dietary Fats | 18457598 |
| Obesity | inferred via Dietary Fats | 18457598, 17217161 |
| Kidney Diseases | inferred via Cadmium Chloride | 16962696 |
| Cell Transformation, Neoplastic | inferred via Cadmium | 17332340 |
| Kidney Diseases | inferred via Cadmium | 16962696, 16322080 |
| Prostatic Neoplasms | inferred via Cadmium | 17075824 |
Selected Publications
[
] Gene-related publications indexed at PubMed
- [
] Omi S, et al. (2008) "Contribution of peroxisome-specific isoform of Lon protease in sorting PTS1 proteins to peroxisomes." J Biochem. 143(5):649-660. PMID:18281296 - [
] Barbe L, et al. (2008) "Toward a confocal subcellular atlas of the human proteome." Mol Cell Proteomics. 7(3):499-508. PMID:18029348 - [
] Park HC, et al. (2005) "Polymorphism of the ACE Gene in dialysis patients: overexpression of DD genotype in type 2 diabetic end-stage renal failure patients." Yonsei Med J. 46(6):779-787. PMID:16385653 - [
] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334 - [
] Patel S, et al. (2003) "Angiotensin-converting enzyme genotype and the ventilatory response to exertional hypoxia." Eur Respir J. 22(5):755-760. PMID:14621081 - [
] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932 - [
] Lawrence JW, et al. (2001) "Differential gene regulation in human versus rodent hepatocytes by peroxisome proliferator-activated receptor (PPAR) alpha. PPAR alpha fails to induce peroxisome proliferation-associated genes in human cells independently of the level of receptor expresson." J Biol Chem. 276(34):31521-31527. PMID:11418601 - [
] Fujiwara C, et al. (2000) "Catalase-less peroxisomes. Implication in the milder forms of peroxisome biogenesis disorder." J Biol Chem. 275(47):37271-37277. PMID:10960480 - [
] Daigo Y, et al. (1999) "Characterization of a 1200-kb genomic segment of chromosome 3p22-p21.3." DNA Res. 6(1):37-44. PMID:10231028 - [
] Yu W, et al. (1997) "Large-scale concatenation cDNA sequencing." Genome Res. 7(4):353-358. PMID:9110174 - [
] Andersson B, et al. (1996) "A "double adaptor" method for improved shotgun library construction." Anal Biochem. 236(1):107-113. PMID:8619474 - [
] Ottone F, et al. (1995) "Refined localization of human peroxisomal 3-oxoacyl-CoA thiolase (ACAA) to 3p22." Hum Hered. 45(2):75-79. PMID:7750978 - [
] Bout A, et al. (1991) "Characterization of the gene encoding human peroxisomal 3-oxoacyl-CoA thiolase (ACAA). No large DNA rearrangement in a thiolase-deficient patient." Biochim Biophys Acta. 1090(1):43-51. PMID:1679347 - [
] Bout A, et al. (1989) "Assignment of the gene coding for human peroxisomal 3-oxoacyl-CoA thiolase (ACAA) to chromosome region 3p22----p23." Cytogenet Cell Genet. 52(3-4):147-150. PMID:2630187 - [
] Fairbairn LJ, et al. (1989) "Complete cDNA sequence of human foetal liver peroxisomal 3-oxoacyl-CoA thiolase." Nucleic Acids Res. 17(9):3588. PMID:2726492 - [
] Bout A, et al. (1988) "Nucleotide sequence of human peroxisomal 3-oxoacyl-CoA thiolase." Nucleic Acids Res. 16(21):10369. PMID:3194209 - [
] Schram AW, et al. (1987) "Human peroxisomal 3-oxoacyl-coenzyme A thiolase deficiency." Proc Natl Acad Sci U S A. 84(8):2494-2496. PMID:2882519
Using an organelle proteomics approach, we previously studied the rat peroxisome in order to characterize the proteins participating in its biogenesis. A peroxisome-specific isoform of Lon (pLon) protein was accordingly identified. However, the precise role of pLon in peroxisomes remains to be elucidated. Here, we demonstrate that pLon plays a role in processing and activating a specific regulatory protein belonging to the peroxisome targeting signal (PTS) 1-containing proteins. Proteomic analysis of proteins co-immunoprecipitated with Lon suggested that Lon interacts with PMP70 and several enzymes involved in beta-oxidation, including acyl-CoA oxidase (AOX). The processing of AOX for its activation in peroxisomes was strongly inhibited in cells expressing a dominant negative form of pLon. Furthermore, a catalase possessing a modified PTS1 sequence was misdistributed in this cell line. pLon exhibits little, if any, in vitro AOX processing activity, and does not process PTS2-containing 3-ketoacyl-coenzyme A thiolase (PTL). Therefore, pLon may specifically control, sort and process PTS1 proteins. Based on the relationship between pLon and the beta-oxidation enzymes that regulate peroxisomal morphology, the observation of enlarged peroxisomes in cells expressing recombinant pLon suggests that pLon is a critical factor determining peroxisome morphology.
Information on protein localization on the subcellular level is important to map and characterize the proteome and to better understand cellular functions of proteins. Here we report on a pilot study of 466 proteins in three human cell lines aimed to allow large scale confocal microscopy analysis using protein-specific antibodies. Approximately 3000 high resolution images were generated, and more than 80% of the analyzed proteins could be classified in one or multiple subcellular compartment(s). The localizations of the proteins showed, in many cases, good agreement with the Gene Ontology localization prediction model. This is the first large scale antibody-based study to localize proteins into subcellular compartments using antibodies and confocal microscopy. The results suggest that this approach might be a valuable tool in conjunction with predictive models for protein localization.
The angiotensin-converting enzyme (ACE) gene DD homozygote has been suggested to be a significant risk factor for the progression of diabetic nephropathy. We analyzed clinical parameters and ACE genotype distribution between type 2 diabetic patients at the extremes of renal risk, i.e. an end-stage renal failure (ESRF) group (n = 103, group 1) who were on dialysis therapy due to progression of diabetic nephropathy, and a no progression group (n = 88, group 2) who had maintained normal renal function and normoalbuminuria for more than 15 years. There were no significant differences in age, sex, body mass index, HbA1c level, or lipid profiles between the two groups (p > 0.05). Group 1 had a significantly higher prevalence of hypertension [group 1: 82.5% (85/103) vs. group 2: 50.0% (44/88), p < 0.05] and diabetic retinopathy [group 1: 103/103 (100%) vs. group 2: 28/88 (31.8%), p < 0.05] than group 2. Daily urinary albumin excretion was also higher in group 1 than in group 2 [group 1: 2873 +/- 2176 mg/day vs. 12 +/- 7 g/day, p < 0.05]. The frequencies of the DD, ID, and II genotypes of the ACE gene in group 1 and group 2 were 26.2%, 47.6%, and 26.2%, and 7.9%, 57.9%, and 34.2%, respectively. The ACE genotype frequencies between the two groups were significantly different according to a chi-square test with Bonferroni's correction (p = 0.004). The presence of the DD genotype increased the risk of ESRF 4.286-fold compared to the II genotype [odds ratio 4.286, 95% CI 1.60- 11.42, p = 0.005]. The frequency of the D-allele was higher in both male and female patients in group 1 compared to group 2, but reached statistical significance only in males [male, group 1: 50.8% vs. group 2: 35.0%, p = 0.018, female, group 1: 48.8% vs. group 2: 39.5%, p = 0.231]. This study, although limited by sample size, showed that type 2 diabetic ESRF patients more frequently expressed the DD genotype. These findings may substantiate the previously noted relationship between the ACE DD genotype and the progression of diabetic nephropathy in Korean type 2 diabetic patients.
The National Institutes of Health's Mammalian Gene Collection (MGC) project was designed to generate and sequence a publicly accessible cDNA resource containing a complete open reading frame (ORF) for every human and mouse gene. The project initially used a random strategy to select clones from a large number of cDNA libraries from diverse tissues. Candidate clones were chosen based on 5'-EST sequences, and then fully sequenced to high accuracy and analyzed by algorithms developed for this project. Currently, more than 11,000 human and 10,000 mouse genes are represented in MGC by at least one clone with a full ORF. The random selection approach is now reaching a saturation point, and a transition to protocols targeted at the missing transcripts is now required to complete the mouse and human collections. Comparison of the sequence of the MGC clones to reference genome sequences reveals that most cDNA clones are of very high sequence quality, although it is likely that some cDNAs may carry missense variants as a consequence of experimental artifact, such as PCR, cloning, or reverse transcriptase errors. Recently, a rat cDNA component was added to the project, and ongoing frog (Xenopus) and zebrafish (Danio) cDNA projects were expanded to take advantage of the high-throughput MGC pipeline.
The "insertion" (I) rather than "deletion" (D) variant of the human angiotensin-converting enzyme (ACE) gene is associated with both lower tissue ACE activity and elite performance at high altitude. Three genotypes, II, ID and DD, are thus represented in the population. The authors examined whether an improved ventilatory response to hypoxic exercise may contribute to this effect. Subjects (n=60; 37 male, mean+/-SEM age 23.6+/-0.6 yrs, 14 II, 30 ID, 16 DD) underwent incremental cardiopulmonary exercise testing to establish maximal oxygen uptake and ventilatory threshold (VT). Four hours later, subjects exercised for 6 mins at 50% of the workload at VT. The protocol was repeated 15 mins later while breathing 12.5+/-0.5% oxygen in nitrogen. All subject characteristics were independent of genotype, as were data during normoxic exercise. However, the hypoxia-induced rise in minute ventilation was significantly greater among those of II genotype (39.6+/-4.1% versus 27.9+/-2.0% versus 28.4+/-2.2% for II versus ID versus DD, respectively). These data are supported by a significantly greater decrease in end tidal carbon dioxide (consistent with an increase in alveolar ventilation) among those homozygous for the I allele (II -18.7+/-1.3%, ID -15.7+/-0.4%, DD -15.1%+/-1.1). The ventilatory response to hypoxic exercise is influenced by angiotensin-converting enzyme genotype. Potential implications concern high altitude performance and the pathogenesis and management of hypoxic lung disease.
The National Institutes of Health Mammalian Gene Collection (MGC) Program is a multiinstitutional effort to identify and sequence a cDNA clone containing a complete ORF for each human and mouse gene. ESTs were generated from libraries enriched for full-length cDNAs and analyzed to identify candidate full-ORF clones, which then were sequenced to high accuracy. The MGC has currently sequenced and verified the full ORF for a nonredundant set of >9,000 human and >6,000 mouse genes. Candidate full-ORF clones for an additional 7,800 human and 3,500 mouse genes also have been identified. All MGC sequences and clones are available without restriction through public databases and clone distribution networks (see http:mgc.nci.nih.gov).
We compared the ability of rat and human hepatocytes to respond to fenofibric acid and a novel potent phenylacetic acid peroxisome proliferator-activated receptor (PPAR) alpha agonist (compound 1). Fatty acyl-CoA oxidase (FACO) activity and mRNA were increased after treatment with either fenofibric acid or compound 1 in rat hepatocytes. In addition, apolipoprotein CIII mRNA was decreased by both fenofibric acid and compound 1 in rat hepatocytes. Both agonists decreased apolipoprotein CIII mRNA in human hepatocytes; however, very little change in FACO activity or mRNA was observed. Furthermore, other peroxisome proliferation (PP)-associated genes including peroxisomal 3-oxoacyl-CoA thiolase (THIO), peroxisomal enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase (HD), peroxisomal membrane protein-70 (PMP-70) were not regulated by PPAR alpha agonists in human hepatocytes. Moreover, other genes that are regulated by PPAR alpha ligands in human hepatocytes such as mitochondrial HMG-CoA synthase and carnitine palmitoyl transferase-1 (CPT-1) were also regulated in HepG2 cells by PPAR alpha agonists. Several stably transfected HepG2 cell lines were established that overexpressed human PPAR alpha to levels between 6- and 26-fold over normal human hepatocytes. These PPAR alpha-overexpressing cells had higher basal mRNA levels of mitochondrial HMG-CoA synthase and CPT-1; however, basal FACO mRNA levels and other PP-associated genes including THIO, HD, or PMP-70 mRNA were not substantially affected. In addition, FACO, THIO, HD, and PMP-70 mRNA levels did not increase in response to PPAR alpha agonist treatment in the PPAR alpha-overexpressing cells, although mitochondrial HMG-CoA synthase and CPT-1 mRNAs were both induced. These results suggest that other factors besides PPAR alpha levels determine the species-specific response of human and rat hepatocytes to the induction of PP.
We established a Chinese hamster ovary cell line having a temperature-sensitive phenotype in peroxisome biogenesis. This mutant (65TS) was produced by transforming a PEX2-defective mutant, Z65, with a mutant PEX2 gene, PEX2(E55K), derived from a patient with infantile Refsum disease, a milder form of peroxisome biogenesis disorder. In 65TS, catalase was found in the cytosol at a nonpermissive temperature (39 degrees C), but upon the shift to a permissive temperature (33 degrees C), catalase gradually localized to the structures containing a 70-kDa peroxisomal membrane protein, PMP70. In contrast to catalase, other matrix proteins containing typical peroxisome targeting signals, acyl-CoA oxidase and peroxisomal 3-ketoacyl-CoA thiolase, were co-localized with PMP70 in most cells, even at 39 degrees C. We found that these structures are partially functional peroxisomes and named them "catalase-less peroxisomes." Catalase-less peroxisomes were also observed in human fibroblasts from patients with milder forms of peroxisome biogenesis disorder, including the one from which the mutant PEX2 gene was derived. We suggest that these structures are the causes of the milder phenotypes of the patients. Temperature-dependent restoration of the peroxisomes in 65TS occurred even in the presence of cycloheximide, a protein synthesis inhibitor. Thus, we conclude that in 65TS, catalase-less peroxisomes are the direct precursors of peroxisomes.
We previously determined the nucleotide sequence and characterized the 685-kb proximal half of CEPH YAC936c1, which corresponds to a portion of human chromosome 3p21.3. In the study reported here, we characterized the remaining 515-kb of this YAC clone corresponding to the telomeric half of its human insert. The newly sequenced region contained a total of ten genes including six reported previously: phospholipase C delta 1 (PLCD1), human activin receptor type IIB (hActR-IIB), organic cation transporter-like 1 (OCTL1), organic cation transporter-like 2 (OCTL2), oxidative stress response 1 (OSR1), and human xylulokinase-like protein (XYLB). The remaining four genes present in the telomeric region included two known genes, MyD88 and ACAA, and two novel genes. One (designated ENGL) of the novel sequences was found to encode an amino-acid sequence homologous to the family of DNA/RNA endonucleases, especially endonuclease G. The other gene F56 revealed no significant homology to any known genes. These results disclosed complete physical and transcriptional maps of the 1200-kb region of 3p present in YAC 936c1.
A total of 100 kb of DNA derived from 69 individual human brain cDNA clones of 0.7-2.0 kb were sequenced by concatenated cDNA sequencing (CCS), whereby multiple individual DNA fragments are sequenced simultaneously in a single shotgun library. The method yielded accurate sequences and a similar efficiency compared with other shotgun libraries constructed from single DNA fragments (> 20 kb). Computer analyses were carried out on 65 cDNA clone sequences and their corresponding end sequences to examine both nucleic acid and amino acid sequence similarities in the databases. Thirty-seven clones revealed no DNA database matches, 12 clones generated exact matches (> or = 98% identity), and 16 clones generated nonexact matches (57%-97% identity) to either known human or other species genes. Of those 28 matched clones, 8 had corresponding end sequences that failed to identify similarities. In a protein similarity search, 27 clone sequences displayed significant matches, whereas only 20 of the end sequences had matches to known protein sequences. Our data indicate that full-length cDNA insert sequences provide significantly more nucleic acid and protein sequence similarity matches than expressed sequence tags (ESTs) for database searching.
The efficiency of shotgun DNA sequencing depends to a great extent on the quality of the random-subclone libraries used. We here describe a novel "double adaptor" strategy for efficient construction of high-quality shotgun libraries. In this method, randomly sheared and end-repaired fragments are ligated to oligonucleotide adaptors creating 12-base overhangs. Nonphosphorylated oligonucleotides are used, which prevents formation of adaptor dimers and ensures efficient ligation of insert to adaptor. The vector is prepared from a modified M13 vector, by KpnI/PstI digestion followed by ligation to oligonucleotides with ends complementary to the overhangs created in the digest. These adaptors create 5'-overhangs complementary to those on the inserts. Following annealing of insert to vector, the DNA is directly used for transformation without a ligation step. This protocol is robust and shows three- to fivefold higher yield of clones compared to previous protocols. No chimeric clones can be detected and the background of clones without an insert is <1%. The procedure is rapid and shows potential for automation.
The chromosomal localisation of the human gene coding for peroxisomal 3-oxoacyl-CoA thiolase (ACAA) was determined by human-hamster somatic cell hybrids and fluorescence in situ hybridisation, using cDNA and genomic probes, respectively. The results allowed an exclusion of the previously suggested presence of a second site for ACAA on chromosome 11 and an assignment of the gene to a single chromosome band (3p22).
We have characterized the gene encoding human peroxisomal 3-oxoacyl-CoA thiolase, an enzyme operative in the peroxisomal beta-oxidation system. We found one version of this gene (gene symbol ACAA) in the human genome, in contrast to the situation in rat where two versions have been described. The human gene shows a high structural similarity to the rat genes. It contains 12 exons and 11 introns and spans about 11 kb. We have determined the 5' end of the human thiolase mRNA by employing primer extension analysis and we have sequenced the region upstream of the gene. The putative promoter area displays some of the characteristics typical of promoters of other peroxisomal genes, in that it contains GC elements, but lacks TATA boxes. Finally, no large DNA rearrangement involving the thiolase gene could be observed in a patient suffering from pseudo-Zellweger syndrome (peroxisomal thiolase deficiency).
The chromosomal location of the human gene coding for peroxisomal 3-oxoacyl-CoA thiolase (ACAA) was determined with the aid of cDNA and genomic probes by screening of rodent x human somatic cell hybrids and in situ hybridization. The results localize the gene to chromosome region 3p22----p23.
We investigated the peroxisomal beta-oxidation system in liver from a patient with clinical features similar to those in the cerebrohepatorenal (Zellweger) syndrome and with elevated levels in body fluids of very-long-chain fatty acids and intermediates in the biosynthesis of bile acids. The peroxisomal beta-oxidation of fatty acids, measured as the cyanide-insensitive formation of [14C]acetyl units from [14C]palmitoyl-CoA, was very low in the patient (less than 10% of the values in control subjects). Immunoblotting experiments using antibodies to peroxisomal beta-oxidation enzymes indicated that peroxisomal 3-oxoacyl-CoA thiolase (acyl-CoA:acetyl-CoA C-acyltransferase, EC 2.3.1.16) was deficient. Addition of purified rat-liver peroxisomal 3-oxoacyl-CoA thiolase to a reaction mixture containing liver homogenate from the patient restored peroxisomal beta-oxidation. We conclude that the deficiency of peroxisomal 3-oxoacyl-CoA thiolase is responsible for the very low peroxisomal beta-oxidation activity and for the accumulation of very-long-chain fatty acids and intermediates in the biosynthesis of bile acids. Furthermore, the finding that both very-long-chain fatty acids and abnormal bile acids accumulate in this patient suggests that a single peroxisomal 3-oxoacyl-CoA thiolase is involved in the oxidative chain shortening of both very-long-chain fatty acids and the coprostanoic acids.

