ACAA1 | GeneID:30 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 30 Official Symbol ACAA1
Locus N/A Gene Type protein-coding
Synonyms ACAA; PTHIO; THIO
Full Name acetyl-Coenzyme A acyltransferase 1
Description acetyl-Coenzyme A acyltransferase 1
Chromosome 3p23-p22
Also Known As peroxisomal 3-oxoacyl-Coenzyme A thiolase
Summary This gene encodes an enzyme operative in the beta-oxidation system of the peroxisomes. Deficiency of this enzyme leads to pseudo-Zellweger syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 37497

ID Symbol Protein Species
GeneID:30 ACAA1 NP_001598.1 Homo sapiens
GeneID:24157 Acaa1 NP_036621.1 Rattus norvegicus
GeneID:113868 Acaa1a NP_570934.1 Mus musculus
GeneID:460268 ACAA1 XP_001171323.1 Pan troglodytes
GeneID:477023 ACAA1 XP_534222.2 Canis lupus familiaris
GeneID:501072 RGD1562373 XP_001062085.1 Rattus norvegicus
GeneID:508324 ACAA1 NP_001029491.1 Bos taurus
GeneID:770094 ACAA1 XP_001232577.1 Gallus gallus
GeneID:817876 KAT2/PED1 NP_180873.1 Arabidopsis thaliana
GeneID:839434 AT1G04710 NP_171965.1 Arabidopsis thaliana
GeneID:2682904 MGG_10700 XP_367070.1 Magnaporthe grisea
GeneID:2712196 NCU09646.1 XP_330296.1 Neurospora crassa
GeneID:4331150 Os02g0817700 NP_001048523.1 Oryza sativa

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 sigma HPA007244 Anti-ACAA1 antibody produced in rabbit ;
2 sigma HPA006764 Anti-ACAA1 antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of ACAA1 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ACAA1 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0043231 Component intracellular membrane-bounded organelle
GO:0005777 Component peroxisome
GO:0003988 Function acetyl-CoA C-acyltransferase activity
GO:0008415 Function acyltransferase activity
GO:0005515 Function protein binding
GO:0016740 Function transferase activity
GO:0006631 Process fatty acid metabolic process
GO:0006091 Process generation of precursor metabolites and energy
GO:0006629 Process lipid metabolic process
GO:0008152 Process metabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001130410  UCSC Browser NP_001123882
2 NM_001607  UCSC Browser NP_001598
3 NR_024024  UCSC Browser

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000333167 MI0000064 hsa-let-7c* UAGAGUUACACCCUGGGAGUUA
ENST00000333167 MI0000443 hsa-miR-124* CGUGUUCACAGCGGACCUUGAU
ENST00000333167 MI0000444 hsa-miR-124* CGUGUUCACAGCGGACCUUGAU
ENST00000333167 MI0000445 hsa-miR-124* CGUGUUCACAGCGGACCUUGAU
ENST00000333167 MI0000448 hsa-miR-130a* UUCACAUUGUGCUACUGUCUGC
ENST00000333167 MI0000449 hsa-miR-132* ACCGUGGCUUUCGAUUGUUACU
ENST00000333167 MI0000452 hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENST00000333167 MI0000453 hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENST00000333167 MI0000810 hsa-miR-135b UAUGGCUUUUCAUUCCUAUGUGA
ENST00000333167 MI0000458 hsa-miR-142-3p UGUAGUGUUUCCUACUUUAUGGA
ENST00000333167 MI0000262 hsa-miR-147 GUGUGUGGAAAUGCUUCUGC
ENST00000333167 MI0000463 hsa-miR-153 UUGCAUAGUCACAAAAGUGAUC
ENST00000333167 MI0000464 hsa-miR-153 UUGCAUAGUCACAAAAGUGAUC
ENST00000333167 MI0000069 hsa-miR-15a UAGCAGCACAUAAUGGUUUGUG
ENST00000333167 MI0000438 hsa-miR-15b UAGCAGCACAUCAUGGUUUACA
ENST00000333167 MI0000070 hsa-miR-16 UAGCAGCACGUAAAUAUUGGCG
ENST00000333167 MI0000115 hsa-miR-16 UAGCAGCACGUAAAUAUUGGCG
ENST00000333167 MI0000271 hsa-miR-181c* AACCAUCGACCGUUGAGUGGAC
ENST00000333167 MI0000239 hsa-miR-197 UUCACCACCUUCUCCACCCAGC
ENST00000333167 MI0000242 hsa-miR-199a-5p CCCAGUGUUCAGACUACCUGUUC
ENST00000333167 MI0000281 hsa-miR-199a-5p CCCAGUGUUCAGACUACCUGUUC
ENST00000333167 MI0000282 hsa-miR-199b-5p CCCAGUGUUUAGACUAUCUGUUC
ENST00000333167 MI0000073 hsa-miR-19a* AGUUUUGCAUAGUUGCACUACA
ENST00000333167 MI0000074 hsa-miR-19b-1* AGUUUUGCAGGUUUGCAUCCAGC
ENST00000333167 MI0000075 hsa-miR-19b-2* AGUUUUGCAGGUUUGCAUUUCA
ENST00000333167 MI0003130 hsa-miR-202* UUCCUAUGCAUAUACUUCUUUG
ENST00000333167 MI0000077 hsa-miR-21* CAACACCAGUCGAUGGGCUGU
ENST00000333167 MI0000290 hsa-miR-214 ACAGCAGGCACAGACAGGCAGU
ENST00000333167 MI0000296 hsa-miR-219-1-3p AGAGUUGAGUCUGGACGUCCCG
ENST00000333167 MI0005529 hsa-miR-220b CCACCACCGUGUCUGACACUU
ENST00000333167 MI0000079 hsa-miR-23a AUCACAUUGCCAGGGAUUUCC
ENST00000333167 MI0000439 hsa-miR-23b AUCACAUUGCCAGGGAUUACC
ENST00000333167 MI0000082 hsa-miR-25 CAUUGCACUUGUCUCGGUCUGA
ENST00000333167 MI0000738 hsa-miR-302a UAAGUGCUUCCAUGUUUUGGUGA
ENST00000333167 MI0000772 hsa-miR-302b UAAGUGCUUCCAUGUUUUAGUAG
ENST00000333167 MI0000773 hsa-miR-302c UAAGUGCUUCCAUGUUUCAGUGG
ENST00000333167 MI0000774 hsa-miR-302d UAAGUGCUUCCAUGUUUGAGUGU
ENST00000333167 MI0000089 hsa-miR-31* UGCUAUGCCAACAUAUUGCCAU
ENST00000333167 MI0000090 hsa-miR-32 UAUUGCACAUUACUAAGUUGCA
ENST00000333167 MI0000806 hsa-miR-337-3p CUCCUAUAUGAUGCCUUUCUUC
ENST00000333167 MI0000815 hsa-miR-339-3p UGAGCGCCUCGACGACAGAGCCG
ENST00000333167 MI0003646 hsa-miR-33b GUGCAUUGCUGUUGCAUUGC
ENST00000333167 MI0003646 hsa-miR-33b* CAGUGCCUCGGCAGUGCAGCCC
ENST00000333167 MI0000764 hsa-miR-363 AAUUGCACGGUAUCCAUCUGUA
ENST00000333167 MI0000767 hsa-miR-365 UAAUGCCCCUAAAAAUCCUUAU
ENST00000333167 MI0000769 hsa-miR-365 UAAUGCCCCUAAAAAUCCUUAU
ENST00000333167 MI0000775 hsa-miR-367 AAUUGCACUUUAGCAAUGGUGA
ENST00000333167 MI0000779 hsa-miR-371-3p AAGUGCCGCCAUCUUUUGAGUGU
ENST00000333167 MI0000781 hsa-miR-373 GAAGUGCUUCGAUUUUGGGGUGU
ENST00000333167 MI0001735 hsa-miR-409-5p AGGUUACCCGAGCAACUUUGCAU
ENST00000333167 MI0002464 hsa-miR-412 ACUUCACCUGGUCCACUAGCCGU
ENST00000333167 MI0001721 hsa-miR-431 UGUCUUGCAGGCCGUCAUGCA
ENST00000333167 MI0001729 hsa-miR-451 AAACCGUUACCAUUACUGAGUU
ENST00000333167 MI0001733 hsa-miR-452 AACUGUUUGCAGAGGAAACUGA
ENST00000333167 MI0002467 hsa-miR-483-3p UCACUCCUCUCCUCCCGUCUU
ENST00000333167 MI0002470 hsa-miR-486-5p UCCUGUACUGAGCUGCCCCGAG
ENST00000333167 MI0003125 hsa-miR-490-5p CCAUGGAUCUCCAGGUGGGU
ENST00000333167 MI0003138 hsa-miR-497 CAGCAGCACACUGUGGUUUGU
ENST00000333167 MI0003188 hsa-miR-503 UAGCAGCGGGAACAGUUCUGCAG
ENST00000333167 MI0003190 hsa-miR-505 CGUCAACACUUGCUGGUUUCCU
ENST00000333167 MI0003194 hsa-miR-507 UUUUGCACCUUUUGGAGUGAA
ENST00000333167 MI0003140 hsa-miR-512-3p AAGUGCUGUCAUAGCUGAGGUC
ENST00000333167 MI0003141 hsa-miR-512-3p AAGUGCUGUCAUAGCUGAGGUC
ENST00000333167 MI0003144 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENST00000333167 MI0003147 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENST00000333167 MI0003161 hsa-miR-517a AUCGUGCAUCCCUUUAGAGUGU
ENST00000333167 MI0003174 hsa-miR-517c AUCGUGCAUCCUUUUAGAGUGU
ENST00000333167 MI0003171 hsa-miR-518d-5p CUCUAGAGGGAAGCACUUUCUG
ENST00000333167 MI0003169 hsa-miR-518e AAAGCGCUUCCCUUCAGAGUG
ENST00000333167 MI0003169 hsa-miR-518e* CUCUAGAGGGAAGCGCUUUCUG
ENST00000333167 MI0003154 hsa-miR-518f* CUCUAGAGGGAAGCACUUUCUC
ENST00000333167 MI0003145 hsa-miR-519e AAGUGCCUCCUUUUAGAGUGUU
ENST00000333167 MI0003149 hsa-miR-520a-3p AAAGUGCUUCCCUUUGGACUGU
ENST00000333167 MI0003164 hsa-miR-520d-3p AAAGUGCUUCUCUUUGGUGGGU
ENST00000333167 MI0003205 hsa-miR-532-5p CAUGCCUUGAGUGUAGGACCGU
ENST00000333167 MI0003556 hsa-miR-551a GCGACCCACUCUUGGUUUCCA
ENST00000333167 MI0003575 hsa-miR-551b GCGACCCAUACUUGGUUUCAG
ENST00000333167 MI0003563 hsa-miR-557 GUUUGCACGGGUGGGCCUUGUCU
ENST00000333167 MI0003572 hsa-miR-566 GGGCGCCUGUGAUCCCAAC
ENST00000333167 MI0003580 hsa-miR-573 CUGAAGUGAUGUGUAACUGAUCAG
ENST00000333167 MI0003603 hsa-miR-591 AGACCAUGGGUUCUCAUUGU
ENST00000333167 MI0003623 hsa-miR-610 UGAGCUAAAUGUGUGCUGGGA
ENST00000333167 MI0003647 hsa-miR-632 GUGUCUGCUUCCUGUGGGA
ENST00000333167 MI0003654 hsa-miR-639 AUCGCUGCGGUUGCGAGCGCUGU
ENST00000333167 MI0003655 hsa-miR-640 AUGAUCCAGGAACCUGCCUCU
ENST00000333167 MI0003658 hsa-miR-643 ACUUGUAUGCUAGCUCAGGUAG
ENST00000333167 MI0003676 hsa-miR-654-3p UAUGUCUGCUGACCAUCACCUU
ENST00000333167 MI0003684 hsa-miR-660 UACCCAUUGCAUAUCGGAGUUG
ENST00000333167 MI0003669 hsa-miR-661 UGCCUGGGUCUCUGGCCUGCGCGU
ENST00000333167 MI0003836 hsa-miR-766 ACUCCAGCCCCACAGCCUCAGC
ENST00000333167 MI0005542 hsa-miR-876-3p UGGUGGUUUACAAAGUAAUUCA
ENST00000333167 MI0005528 hsa-miR-892a CACUGUGUCCUUUCUGCGUAG
ENST00000333167 MI0000093 hsa-miR-92a UAUUGCACUUGUCCCGGCCUGU
ENST00000333167 MI0000094 hsa-miR-92a UAUUGCACUUGUCCCGGCCUGU
ENST00000333167 MI0003560 hsa-miR-92b UAUUGCACUCGUCCCGGCCUCC
ENST00000333167 MI0005756 hsa-miR-934 UGUCUACUACUGGAGACACUGG
ENST00000333167 MI0005768 hsa-miR-943 CUGACUGUUGCCGUCCUCCAG
ENST00000333167 MI0000098 hsa-miR-96* AAUCAUGUGCAGUGCCAAUAUG
ENST00000333167 MI0000388 mmu-miR-290-3p AAAGUGCCGCCUAGUUUUAAGCCC
ENST00000333167 MI0000389 mmu-miR-291a-3p AAAGUGCUUCCACUUUGUGUGC
ENST00000333167 MI0000390 mmu-miR-292-3p AAAGUGCCGCCAGGUUUUGAGUGU
ENST00000333167 MI0002402 mmu-miR-467a UAAGUGCCUGCAUGUAUAUGCG
ENST00000333167 MI0004647 mmu-miR-684 AGUUUUCCCUUCAAGUCAA
ENST00000333167 MI0004648 mmu-miR-684 AGUUUUCCCUUCAAGUCAA
ENST00000333167 MI0004306 mmu-miR-761 GCAGCAGGGUGAAACUGACACA
ENST00000333167 MI0005204 mmu-miR-805 GAAUUGAUCAGGACAUAGGG
ENST00000333167 MI0005473 mmu-miR-880 UACUCCAUCCUCUCUGAGUAGA
ENST00000333167 MI0000644 rno-miR-352 AGAGUAGUAGGUUGCAUAGUA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Cadmium
  • Cadmium results in increased expression of ACAA1 mRNA
17327699
Cadmium Chloride
  • Cadmium Chloride results in increased expression of ACAA1 mRNA
17327699
Dietary Fats
  • Dietary Fats results in increased expression of ACAA1 mRNA
18457598, 16357043
furan
  • furan results in decreased expression of ACAA1 mRNA
15120968
Hydralazine
  • [Hydralazine co-treated with Valproic Acid] results in increased expression of ACAA1 mRNA
17183730
Methapyrilene
  • Methapyrilene results in decreased expression of ACAA1 mRNA
15120968
Methotrexate
  • Methotrexate results in decreased expression of ACAA1 mRNA
15120968
perfluorooctane sulfonic acid
  • perfluorooctane sulfonic acid results in increased expression of ACAA1 mRNA
16221955
perfluorooctanoic acid
  • perfluorooctanoic acid results in increased expression of ACAA1 mRNA
16221955
Phthalic Acids
  • Phthalic Acids results in decreased expression of ACAA1 mRNA
15728792
pirinixic acid
  • pirinixic acid results in increased expression of ACAA1 mRNA
16940010
pirinixic acid
  • pirinixic acid results in increased expression of ACAA1 mRNA
16357043, 15375163
Tetrachlorodibenzodioxin
  • Tetrachlorodibenzodioxin results in increased expression of ACAA1 mRNA
16960034, 16054898
Valproic Acid
  • [Hydralazine co-treated with Valproic Acid] results in increased expression of ACAA1 mRNA
17183730

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
D-BIFUNCTIONAL PROTEIN DEFICIENCY marker
Dystonia inferred via Valproic Acid 1851702
Fatty Liver inferred via Valproic Acid 14986274
Leukemia, Myeloid, Acute inferred via Valproic Acid 16294345
Migraine Disorders inferred via Valproic Acid 18765137, 18803445
Pseudolymphoma inferred via Valproic Acid 12752131
Seizures inferred via Valproic Acid 11738929
Unverricht-Lundborg Syndrome inferred via Valproic Acid 3119515
Adenoma, Liver Cell inferred via Tetrachlorodibenzodioxin 16835633
Carcinoma inferred via Tetrachlorodibenzodioxin 16835633
Cholangiocarcinoma inferred via Tetrachlorodibenzodioxin 16835633
Cleft Palate inferred via Tetrachlorodibenzodioxin 8697196
Diabetes Mellitus, Type 2 inferred via Tetrachlorodibenzodioxin 17107852
Hydronephrosis inferred via Tetrachlorodibenzodioxin 8697196
Liver Neoplasms inferred via Tetrachlorodibenzodioxin 16984957
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375
Edema inferred via perfluorooctanoic acid 17259670, 12083418
Hepatomegaly inferred via perfluorooctanoic acid 3609246
Hyperalgesia inferred via perfluorooctanoic acid 12083418
Inflammation inferred via perfluorooctanoic acid 12083418
Leydig Cell Tumor inferred via perfluorooctanoic acid 8812269
Liver Neoplasms inferred via perfluorooctanoic acid 14757943
Niemann-Pick Disease, Type C inferred via perfluorooctanoic acid 9802331
Prenatal Exposure Delayed Effects inferred via perfluorooctanoic acid 17132714
Glioblastoma inferred via perfluorooctane sulfonic acid 17162496
Arthritis, Rheumatoid inferred via Methotrexate 17286800
Breast Neoplasms inferred via Methotrexate 16978400
Graft vs Host Disease inferred via Methotrexate 16518429
Liver Cirrhosis inferred via Methotrexate 14986274
Mucositis inferred via Methotrexate 17488658
Psoriasis inferred via Methotrexate 17410198
Liver Neoplasms inferred via Methapyrilene 15890375
Hypertension, Pregnancy-Induced inferred via Hydralazine 16612254
Arteriosclerosis inferred via Dietary Fats 15238619
Dyslipidemias inferred via Dietary Fats 18367378
Insulin Resistance inferred via Dietary Fats 18457598
Obesity inferred via Dietary Fats 18457598, 17217161
Kidney Diseases inferred via Cadmium Chloride 16962696
Cell Transformation, Neoplastic inferred via Cadmium 17332340
Kidney Diseases inferred via Cadmium 16962696, 16322080
Prostatic Neoplasms inferred via Cadmium 17075824

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Omi S, et al. (2008) "Contribution of peroxisome-specific isoform of Lon protease in sorting PTS1 proteins to peroxisomes." J Biochem. 143(5):649-660. PMID:18281296
  2. [ + ] Barbe L, et al. (2008) "Toward a confocal subcellular atlas of the human proteome." Mol Cell Proteomics. 7(3):499-508. PMID:18029348
  3. [ + ] Park HC, et al. (2005) "Polymorphism of the ACE Gene in dialysis patients: overexpression of DD genotype in type 2 diabetic end-stage renal failure patients." Yonsei Med J. 46(6):779-787. PMID:16385653
  4. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  5. [ + ] Patel S, et al. (2003) "Angiotensin-converting enzyme genotype and the ventilatory response to exertional hypoxia." Eur Respir J. 22(5):755-760. PMID:14621081
  6. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  7. [ + ] Lawrence JW, et al. (2001) "Differential gene regulation in human versus rodent hepatocytes by peroxisome proliferator-activated receptor (PPAR) alpha. PPAR alpha fails to induce peroxisome proliferation-associated genes in human cells independently of the level of receptor expresson." J Biol Chem. 276(34):31521-31527. PMID:11418601
  8. [ + ] Fujiwara C, et al. (2000) "Catalase-less peroxisomes. Implication in the milder forms of peroxisome biogenesis disorder." J Biol Chem. 275(47):37271-37277. PMID:10960480
  9. [ + ] Daigo Y, et al. (1999) "Characterization of a 1200-kb genomic segment of chromosome 3p22-p21.3." DNA Res. 6(1):37-44. PMID:10231028
  10. [ + ] Yu W, et al. (1997) "Large-scale concatenation cDNA sequencing." Genome Res. 7(4):353-358. PMID:9110174
  11. [ + ] Andersson B, et al. (1996) "A "double adaptor" method for improved shotgun library construction." Anal Biochem. 236(1):107-113. PMID:8619474
  12. [ + ] Ottone F, et al. (1995) "Refined localization of human peroxisomal 3-oxoacyl-CoA thiolase (ACAA) to 3p22." Hum Hered. 45(2):75-79. PMID:7750978
  13. [ + ] Bout A, et al. (1991) "Characterization of the gene encoding human peroxisomal 3-oxoacyl-CoA thiolase (ACAA). No large DNA rearrangement in a thiolase-deficient patient." Biochim Biophys Acta. 1090(1):43-51. PMID:1679347
  14. [ + ] Bout A, et al. (1989) "Assignment of the gene coding for human peroxisomal 3-oxoacyl-CoA thiolase (ACAA) to chromosome region 3p22----p23." Cytogenet Cell Genet. 52(3-4):147-150. PMID:2630187
  15. [ + ] Fairbairn LJ, et al. (1989) "Complete cDNA sequence of human foetal liver peroxisomal 3-oxoacyl-CoA thiolase." Nucleic Acids Res. 17(9):3588. PMID:2726492
  16. [ + ] Bout A, et al. (1988) "Nucleotide sequence of human peroxisomal 3-oxoacyl-CoA thiolase." Nucleic Acids Res. 16(21):10369. PMID:3194209
  17. [ + ] Schram AW, et al. (1987) "Human peroxisomal 3-oxoacyl-coenzyme A thiolase deficiency." Proc Natl Acad Sci U S A. 84(8):2494-2496. PMID:2882519