A1CF | GeneID:29974 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 29974 Official Symbol A1CF
Locus N/A Gene Type protein-coding
Synonyms ACF; ACF64; ACF65; APOBEC1CF; ASP; MGC163391; RP11-564C4.2
Full Name APOBEC1 complementation factor
Description APOBEC1 complementation factor
Chromosome 10q11.23
Also Known As APOBEC-1 stimulating protein; OTTHUMP00000019611; OTTHUMP00000019612; OTTHUMP00000019614; OTTHUMP00000019615; OTTHUMP00000061209; apo-B RNA editing protein; apobec-1 complementation factor; apobec-1 complementation factor (ACF) (ASP)
Summary Mammalian apolipoprotein B mRNA undergoes site-specific C to U deamination, which is mediated by a multi-component enzyme complex containing a minimal core composed of APOBEC-1 and a complementation factor encoded by this gene. The gene product has three non-identical RNA recognition motifs and belongs to the hnRNP R family of RNA-binding proteins. It has been proposed that this complementation factor functions as an RNA-binding subunit and docks APOBEC-1 to deaminate the upstream cytidine. Studies suggest that the protein may also be involved in other RNA editing or RNA processing events. Alternative splicing occurs at this locus and three full-length transcript variants, encoding three distinct isoforms, have been described. Additional splicing has been observed but the full-length nature of these variants has not been determined. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 16363

ID Symbol Protein Species
GeneID:29974 A1CF NP_620310.1 Homo sapiens
GeneID:69865 A1cf NP_001074543.1 Mus musculus
GeneID:170912 A1cf NP_596891.1 Rattus norvegicus
GeneID:423680 A1CF XP_421561.2 Gallus gallus
GeneID:466076 A1CF XP_001162517.1 Pan troglodytes
GeneID:477581 A1CF XP_534776.2 Canis lupus familiaris
GeneID:562916 a1cf XP_685178.1 Danio rerio
GeneID:613704 A1CF XP_869839.2 Bos taurus

Exon, Intron and UTRs

Exon, Intron and UTRs of A1CF Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of A1CF Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0030895 Component apolipoprotein B mRNA editing enzyme complex
GO:0005737 Component cytoplasm
GO:0005783 Component endoplasmic reticulum
GO:0005634 Component nucleus
GO:0003725 Function double-stranded RNA binding
GO:0000166 Function nucleotide binding
GO:0005515 Function protein binding
GO:0003727 Function single-stranded RNA binding
GO:0006397 Process mRNA processing
GO:0050821 Process protein stabilization

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_014576  UCSC Browser NP_055391 A8K7G7   Q9NQ94  
2 NM_138932  UCSC Browser NP_620310 A1L4F2   Q9NQ94  
3 NM_138933  UCSC Browser NP_620311

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000282641 MI0000066 hsa-let-7e* CUAUACGGCCUCCUAGCUUUCC
ENST00000282641 MI0000068 hsa-let-7f-2* CUAUACAGUCUACUGUCUUUCC
ENST00000282641 MI0000446 hsa-miR-125b-1* ACGGGUUAGGCUCUUGGGAGCU
ENST00000282641 MI0000272 hsa-miR-182* UGGUUCUAGACUUGCCAACUA
ENST00000282641 MI0000295 hsa-miR-218-2* CAUGGUUCUGUCAAGCACCGCG
ENST00000282641 MI0001723 hsa-miR-433 AUCAUGAUGGGCUCCUCGGUGU
ENST00000282641 MI0003123 hsa-miR-488 UUGAAAGGCUAUUUCUUGGUC
ENST00000282641 MI0003134 hsa-miR-494 UGAAACAUACACGGGAAACCUC
ENST00000282641 MI0003196 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENST00000282641 MI0005530 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENST00000282641 MI0005717 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENST00000282641 MI0003159 hsa-miR-518c* UCUCUGGAGGGAAGCACUUUCUG
ENST00000282641 MI0003591 hsa-miR-584 UUAUGGUUUGCCUGGGACUGAG
ENST00000282641 MI0003605 hsa-miR-593 UGUCUCUGCUGGGGUUUCU
ENST00000282641 MI0003629 hsa-miR-616 AGUCAUUGGAGGGUUUGAGCAG
ENST00000282641 MI0005542 hsa-miR-876-5p UGGAUUUCUUUGUGAAUCACCA
ENST00000282641 MI0005716 hsa-miR-924 AGAGUCUUGUGAUGUCUUGC
ENST00000282641 MI0004523 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENST00000282641 MI0004667 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENST00000282641 MI0004668 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENST00000282641 MI0004666 mmu-miR-669b AGUUUUGUGUGCAUGUGCAUGU
ENST00000282641 MI0004644 mmu-miR-682 CUGCAGUCACAGUGAAGUCUG
ENST00000373995 MI0000066 hsa-let-7e* CUAUACGGCCUCCUAGCUUUCC
ENST00000373995 MI0000068 hsa-let-7f-2* CUAUACAGUCUACUGUCUUUCC
ENST00000373995 MI0000446 hsa-miR-125b-1* ACGGGUUAGGCUCUUGGGAGCU
ENST00000373995 MI0000272 hsa-miR-182* UGGUUCUAGACUUGCCAACUA
ENST00000373995 MI0000274 hsa-miR-187 UCGUGUCUUGUGUUGCAGCCGG
ENST00000373995 MI0000295 hsa-miR-218-2* CAUGGUUCUGUCAAGCACCGCG
ENST00000373995 MI0001723 hsa-miR-433 AUCAUGAUGGGCUCCUCGGUGU
ENST00000373995 MI0003123 hsa-miR-488 UUGAAAGGCUAUUUCUUGGUC
ENST00000373995 MI0003134 hsa-miR-494 UGAAACAUACACGGGAAACCUC
ENST00000373995 MI0003196 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENST00000373995 MI0005530 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENST00000373995 MI0005717 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENST00000373995 MI0003159 hsa-miR-518c* UCUCUGGAGGGAAGCACUUUCUG
ENST00000373995 MI0003148 hsa-miR-519c-3p AAAGUGCAUCUUUUUAGAGGAU
ENST00000373995 MI0003591 hsa-miR-584 UUAUGGUUUGCCUGGGACUGAG
ENST00000373995 MI0003605 hsa-miR-593 UGUCUCUGCUGGGGUUUCU
ENST00000373995 MI0003629 hsa-miR-616 AGUCAUUGGAGGGUUUGAGCAG
ENST00000373995 MI0003678 hsa-miR-656 AAUAUUAUACAGUCAACCUCU
ENST00000373995 MI0005541 hsa-miR-875-3p CCUGGAAACACUGAGGUUGUG
ENST00000373995 MI0005542 hsa-miR-876-5p UGGAUUUCUUUGUGAAUCACCA
ENST00000373995 MI0005716 hsa-miR-924 AGAGUCUUGUGAUGUCUUGC
ENST00000373995 MI0004523 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENST00000373995 MI0004667 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENST00000373995 MI0004668 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENST00000373995 MI0004666 mmu-miR-669b AGUUUUGUGUGCAUGUGCAUGU
ENST00000373995 MI0004644 mmu-miR-682 CUGCAGUCACAGUGAAGUCUG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Flavonoids
  • Flavonoids results in decreased expression of A1CF mRNA
18035473

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Inflammation inferred via Flavonoids 17296493

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Ishii H, et al. (2009) "Mi2beta shows chromatin enzyme specificity by erasing a DNase I-hypersensitive site established by ACF." J Biol Chem. 284(12):7533-7541. PMID:19158090
  2. [ + ] Blanc V, et al. (2005) "Targeted deletion of the murine apobec-1 complementation factor (acf) gene results in embryonic lethality." Mol Cell Biol. 25(16):7260-7269. PMID:16055734
  3. [ + ] Xie K, et al. (2004) "The structure of a yeast RNA-editing deaminase provides insight into the fold and function of activation-induced deaminase and APOBEC-1." Proc Natl Acad Sci U S A. 101(21):8114-8119. PMID:15148397
  4. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  5. [ + ] Deloukas P, et al. (2004) "The DNA sequence and comparative analysis of human chromosome 10." Nature. 429(6990):375-381. PMID:15164054
  6. [ + ] Blanc V, et al. (2003) "A novel nuclear localization signal in the auxiliary domain of apobec-1 complementation factor regulates nucleocytoplasmic import and shuttling." J Biol Chem. 278(42):41198-41204. PMID:12896982
  7. [ + ] Chester A, et al. (2003) "The apolipoprotein B mRNA editing complex performs a multifunctional cycle and suppresses nonsense-mediated decay." EMBO J. 22(15):3971-3982. PMID:12881431
  8. [ + ] Dance GS, et al. (2002) "Two proteins essential for apolipoprotein B mRNA editing are expressed from a single gene through alternative splicing." J Biol Chem. 277(15):12703-12709. PMID:11815617
  9. [ + ] Mehta A, et al. (2002) "Identification of domains in apobec-1 complementation factor required for RNA binding and apolipoprotein-B mRNA editing." RNA. 8(1):69-82. PMID:11871661
  10. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  11. [ + ] Xu XR, et al. (2001) "Insight into hepatocellular carcinogenesis at transcriptome level by comparing gene expression profiles of hepatocellular carcinoma with those of corresponding noncancerous liver." Proc Natl Acad Sci U S A. 98(26):15089-15094. PMID:11752456
  12. [ + ] Blanc V, et al. (2001) "Identification of GRY-RBP as an apolipoprotein B RNA-binding protein that interacts with both apobec-1 and apobec-1 complementation factor to modulate C to U editing." J Biol Chem. 276(13):10272-10283. PMID:11134005
  13. [ + ] Harrington JJ, et al. (2001) "Creation of genome-wide protein expression libraries using random activation of gene expression." Nat Biotechnol. 19(5):440-445. PMID:11329013
  14. [ + ] Lau PP, et al. (2001) "Two-hybrid cloning identifies an RNA-binding protein, GRY-RBP, as a component of apobec-1 editosome." Biochem Biophys Res Commun. 282(4):977-983. PMID:11352648
  15. [ + ] Blanc V, et al. (2001) "Mutagenesis of apobec-1 complementation factor reveals distinct domains that modulate RNA binding, protein-protein interaction with apobec-1, and complementation of C to U RNA-editing activity." J Biol Chem. 276(49):46386-46393. PMID:11571303
  16. [ + ] Anant S, et al. (2001) "Novel role for RNA-binding protein CUGBP2 in mammalian RNA editing. CUGBP2 modulates C to U editing of apolipoprotein B mRNA by interacting with apobec-1 and ACF, the apobec-1 complementation factor." J Biol Chem. 276(50):47338-47351. PMID:11577082
  17. [ + ] Henderson JO, et al. (2001) "Isolation, characterization and developmental regulation of the human apobec-1 complementation factor (ACF) gene." Biochim Biophys Acta. 1522(1):22-30. PMID:11718896
  18. [ + ] Mehta A, et al. (2000) "Molecular cloning of apobec-1 complementation factor, a novel RNA-binding protein involved in the editing of apolipoprotein B mRNA." Mol Cell Biol. 20(5):1846-1854. PMID:10669759
  19. [ + ] Chester A, et al. (2000) "RNA editing: cytidine to uridine conversion in apolipoprotein B mRNA." Biochim Biophys Acta. 1494(1-2):1-13. PMID:11072063
  20. [ + ] Yang Y, et al. (2000) "Induction of cytidine to uridine editing on cytoplasmic apolipoprotein B mRNA by overexpressing APOBEC-1." J Biol Chem. 275(30):22663-22669. PMID:10833526
  21. [ + ] Lellek H, et al. (2000) "Purification and molecular cloning of a novel essential component of the apolipoprotein B mRNA editing enzyme-complex." J Biol Chem. 275(26):19848-19856. PMID:10781591