Abca7 | GeneID:299609 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 299609 Official Symbol Abca7
Locus N/A Gene Type protein-coding
Synonyms
Full Name ATP-binding cassette, sub-family A (ABC1), member 7
Description ATP-binding cassette, sub-family A (ABC1), member 7
Chromosome 7q11
Also Known As ATP-binding cassette, sub-family A, member 7
Summary may play a role in platelet function [RGD]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 22783

ID Symbol Protein Species
GeneID:10347 ABCA7 NP_061985.2 Homo sapiens
GeneID:27403 Abca7 NP_038878.1 Mus musculus
GeneID:299609 Abca7 NP_997481.1 Rattus norvegicus
GeneID:455538 ABCA7 XP_512226.2 Pan troglodytes
GeneID:485090 ABCA7 XP_542208.2 Canis lupus familiaris
GeneID:511762 ABCA7 XP_589159.3 Bos taurus

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016324 Component apical plasma membrane
GO:0005768 Component endosome
GO:0010008 Component endosome membrane
GO:0005794 Component Golgi apparatus
GO:0000139 Component Golgi membrane
GO:0016021 Component integral to membrane
GO:0005622 Component intracellular
GO:0005886 Component plasma membrane
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0005548 Function phospholipid transporter activity
GO:0006909 Process phagocytosis
GO:0033700 Process phospholipid efflux
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_207598  UCSC Browser NP_997481

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000017623 MI0003131 hsa-miR-492 AGGACCUGCGGGACAAGAUUCUU
ENSRNOT00000017623 MI0003140 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENSRNOT00000017623 MI0003141 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENSRNOT00000017623 MI0003570 hsa-miR-564 AGGCACGGUGUCAGCAGGC
ENSRNOT00000017623 MI0003611 hsa-miR-599 GUUGUGUCAGUUUAUCAAAC
ENSRNOT00000017623 MI0003641 hsa-miR-627 GUGAGUCUCUAAGAAAAGAGGA
ENSRNOT00000017623 MI0003661 hsa-miR-646 AAGCAGCUGCCUCUGAGGC
ENSRNOT00000017623 MI0005538 hsa-miR-892b CACUGGCUCCUUUCUGGGUAGA
ENSRNOT00000017623 MI0005759 hsa-miR-937 AUCCGCGCUCUGACUCUCUGCC
ENSRNOT00000017623 MI0000244 mmu-miR-201 UACUCAGUAAGGCAUUGUUCUU
ENSRNOT00000017623 MI0005002 mmu-miR-490 CAACCUGGAGGACUCCAUGCUG
ENSRNOT00000017623 MI0004134 mmu-miR-668 UGUCACUCGGCUCGGCCCACUACC
ENSRNOT00000017623 MI0004681 mmu-miR-697 AACAUCCUGGUCCUGUGGAGA
ENSRNOT00000017623 MI0004707 mmu-miR-718 CUUCCGCCCGGCCGGGUGUCG
ENSRNOT00000017623 MI0000832 rno-let-7e* CUAUACGGCCUCCUAGCUUUCC
ENSRNOT00000017623 MI0000885 rno-miR-100 AACCCGUAGAUCCGAACUUGUG
ENSRNOT00000017623 MI0000842 rno-miR-10b CCCUGUAGAACCGAAUUUGUGU
ENSRNOT00000017623 MI0000906 rno-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENSRNOT00000017623 MI0003490 rno-miR-133b UUUGGUCCCCUUCAACCAGCUA
ENSRNOT00000017623 MI0000950 rno-miR-210 CUGUGCGUGUGACAGCGGCUGA
ENSRNOT00000017623 MI0000600 rno-miR-327 CCUUGAGGGGCAUGAGGGU
ENSRNOT00000017623 MI0000620 rno-miR-339-5p UCCCUGUCCUCCAGGAGCUCACG
ENSRNOT00000017623 MI0000631 rno-miR-345-5p UGCUGACCCCUAGUCCAGUGC
ENSRNOT00000017623 MI0006154 rno-miR-532-3p CCUCCCACACCCAAGGCUUGCA
ENSRNOT00000017623 MI0003525 rno-miR-543* AAACAUUCGCGGUGCACUUCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Sasaki M, et al. (2003) "Cloning of rat ABCA7 and its preferential expression in platelets." Biochem Biophys Res Commun. 304(4):777-782. PMID:12727224