Abcd4 | GeneID:299196 | Rattus norvegicus
Gene Summary
[
] NCBI Entrez Gene
| Gene ID | 299196 | Official Symbol | Abcd4 |
|---|---|---|---|
| Locus | N/A | Gene Type | protein-coding |
| Synonyms | MGC105956; Pxmp1l | ||
| Full Name | ATP-binding cassette, sub-family D (ALD), member 4 | ||
| Description | ATP-binding cassette, sub-family D (ALD), member 4 | ||
| Chromosome | 6q31 | ||
| Also Known As | ATP-binding cassette, sub-family D, member 4 | ||
| Summary | N/A | ||
Orthologs and Paralogs
[
] Homologs - NCBI's HomoloGene Group: 3703
| ID | Symbol | Protein | Species |
|---|---|---|---|
| GeneID:5826 | ABCD4 | NP_005041.1 | Homo sapiens |
| GeneID:19300 | Abcd4 | NP_033018.1 | Mus musculus |
| GeneID:179968 | pmp-3 | NP_506620.1 | Caenorhabditis elegans |
| GeneID:299196 | Abcd4 | XP_001061210.1 | Rattus norvegicus |
| GeneID:423349 | ABCD4 | XP_421264.2 | Gallus gallus |
| GeneID:453032 | ABCD4 | XP_001156286.1 | Pan troglodytes |
| GeneID:490781 | ABCD4 | XP_547903.2 | Canis lupus familiaris |
| GeneID:767748 | zgc:153503 | NP_001070185.1 | Danio rerio |
| GeneID:841876 | AT1G54350 | NP_175837.2 | Arabidopsis thaliana |
| GeneID:4324587 | Os01g0218700 | NP_001042413.1 | Oryza sativa |
Gene Classification
[
] Gene Ontology
| ID | Category | GO Term |
|---|---|---|
| GO:0005737 | Component | cytoplasm |
| GO:0016020 | Component | membrane |
| GO:0005886 | Component | plasma membrane |
| GO:0006810 | Process | transport |
RefSeq Isoforms
[
] RefSeq Annotation and UniProt Database
| No. | RefSeq RNA | RefSeq Protein | UniProt Equivalent |
|---|---|---|---|
| 1 | NM_001013100 UCSC Browser | NP_001013118 | |
| 2 | XM_001059055 UCSC Browser | XP_001059055 | |
| 3 | XM_001061210 UCSC Browser | XP_001061210 | |
MicroRNA and Targets
[
] MicroRNA Sequences and Transcript Targets from miRBase at Sanger
| RNA Target | miRNA # | mat miRNA | Mature miRNA Sequence |
|---|---|---|---|
| ENSRNOT00000016040 | MI0001446 | hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA |
| ENSRNOT00000016040 | MI0003131 | hsa-miR-492 | AGGACCUGCGGGACAAGAUUCUU |
| ENSRNOT00000016040 | MI0003180 | hsa-miR-516a-3p | UGCUUCCUUUCAGAGGGU |
| ENSRNOT00000016040 | MI0003181 | hsa-miR-516a-3p | UGCUUCCUUUCAGAGGGU |
| ENSRNOT00000016040 | MI0003159 | hsa-miR-518c | CAAAGCGCUUCUCUUUAGAGUGU |
| ENSRNOT00000016040 | MI0003171 | hsa-miR-518d-3p | CAAAGCGCUUCCCUUUGGAGC |
| ENSRNOT00000016040 | MI0003169 | hsa-miR-518e | AAAGCGCUUCCCUUCAGAGUG |
| ENSRNOT00000016040 | MI0003150 | hsa-miR-526b | CUCUUGAGGGAAGCACUUUCUGU |
| ENSRNOT00000016040 | MI0003567 | hsa-miR-561 | CAAAGUUUAAGAUCCUUGAAGU |
| ENSRNOT00000016040 | MI0003580 | hsa-miR-573 | CUGAAGUGAUGUGUAACUGAUCAG |
| ENSRNOT00000016040 | MI0003586 | hsa-miR-579 | UUCAUUUGGUAUAAACCGCGAUU |
| ENSRNOT00000016040 | MI0003608 | hsa-miR-596 | AAGCCUGCCCGGCUCCUCGGG |
| ENSRNOT00000016040 | MI0003625 | hsa-miR-612 | GCUGGGCAGGGCUUCUGAGCUCCUU |
| ENSRNOT00000016040 | MI0003645 | hsa-miR-631 | AGACCUGGCCCAGACCUCAGC |
| ENSRNOT00000016040 | MI0003652 | hsa-miR-637 | ACUGGGGGCUUUCGGGCUCUGCGU |
| ENSRNOT00000016040 | MI0003664 | hsa-miR-649 | AAACCUGUGUUGUUCAAGAGUC |
| ENSRNOT00000016040 | MI0005562 | hsa-miR-887 | GUGAACGGGCGCCAUCCCGAGG |
| ENSRNOT00000016040 | MI0005538 | hsa-miR-892b | CACUGGCUCCUUUCUGGGUAGA |
| ENSRNOT00000016040 | MI0005761 | hsa-miR-939 | UGGGGAGCUGAGGCUCUGGGGGUG |
| ENSRNOT00000016040 | MI0000171 | mmu-miR-149 | UCUGGCUCCGUGUCUUCACUCCC |
| ENSRNOT00000016040 | MI0005004 | mmu-miR-615-5p | GGGGGUCCCCGGUGCUCGGAUC |
| ENSRNOT00000016040 | MI0004662 | mmu-miR-693-3p | GCAGCUUUCAGAUGUGGCUGUAA |
| ENSRNOT00000016040 | MI0004689 | mmu-miR-705 | GGUGGGAGGUGGGGUGGGCA |
| ENSRNOT00000016040 | MI0004124 | mmu-miR-744 | UGCGGGGCUAGGGCUAACAGCA |
| ENSRNOT00000016040 | MI0000835 | rno-let-7i* | CUGCGCAAGCUACUGCCUUGCU |
| ENSRNOT00000016040 | MI0000891 | rno-miR-122 | UGGAGUGUGACAAUGGUGUUUG |
| ENSRNOT00000016040 | MI0000906 | rno-miR-133a | UUUGGUCCCCUUCAACCAGCUG |
| ENSRNOT00000016040 | MI0003490 | rno-miR-133b | UUUGGUCCCCUUCAACCAGCUA |
| ENSRNOT00000016040 | MI0000932 | rno-miR-187 | UCGUGUCUUGUGUUGCAGCCGG |
| ENSRNOT00000016040 | MI0000945 | rno-miR-203 | GUGAAAUGUUUAGGACCACUAG |
| ENSRNOT00000016040 | MI0000851 | rno-miR-22* | AGUUCUUCAGUGGCAAGCUUUA |
| ENSRNOT00000016040 | MI0000870 | rno-miR-30a | UGUAAACAUCCUCGACUGGAAG |
| ENSRNOT00000016040 | MI0000868 | rno-miR-30b-5p | UGUAAACAUCCUACACUCAGCU |
| ENSRNOT00000016040 | MI0000866 | rno-miR-30c | UGUAAACAUCCUACACUCUCAGC |
| ENSRNOT00000016040 | MI0000871 | rno-miR-30c | UGUAAACAUCCUACACUCUCAGC |
| ENSRNOT00000016040 | MI0000867 | rno-miR-30e | UGUAAACAUCCUUGACUGGAAG |
| ENSRNOT00000016040 | MI0000600 | rno-miR-327 | CCUUGAGGGGCAUGAGGGU |
| ENSRNOT00000016040 | MI0000626 | rno-miR-342-5p | AGGGGUGCUAUCUGUGAUUGAG |
| ENSRNOT00000016040 | MI0000635 | rno-miR-347 | UGUCCCUCUGGGUCGCCCA |
| ENSRNOT00000016040 | MI0006145 | rno-miR-423 | AGCUCGGUCUGAGGCCCCUCAGU |
| ENSRNOT00000016040 | MI0001722 | rno-miR-431 | UGUCUUGCAGGCCGUCAUGCA |
| ENSRNOT00000016040 | MI0006151 | rno-miR-484 | UCAGGCUCAGUCCCCUCCCGAU |
| ENSRNOT00000016040 | MI0003555 | rno-miR-503 | UAGCAGCGGGAACAGUACUGCAG |
| ENSRNOT00000016040 | MI0006155 | rno-miR-598-3p | UACGUCAUCGUCGUCAUCGUUA |
Selected Publications
[
] Gene-related publications indexed at PubMed
- [
] Kashiwayama Y, et al. (2009) "70-kDa peroxisomal membrane protein related protein (P70R/ABCD4) localizes to endoplasmic reticulum not peroxisomes, and NH2-terminal hydrophobic property determines the subcellular localization of ABC subfamily D proteins." Exp Cell Res. 315(2):190-205. PMID:19010322 - [
] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
70-kDa peroxisomal membrane protein related protein (P70R/ABCD4) is a member of ATP-binding cassette (ABC) protein subfamily D. ABC subfamily D proteins are also known as peroxisomal ABC proteins. Therefore, P70R is thought to be a peroxisomal membrane protein. However, the subcellular localization of P70R is not extensively investigated. In this study, we transiently expressed P70R in fusion with HA (P70R-HA) in CHO cells and examined subcellular localization by immunofluorescence. Surprisingly, P70R-HA was localized to the endoplasmic reticulum (ER), not to peroxisomes. To examine the ER-targeting property of P70R, we expressed various NH(2)-terminal deletion constructs of P70R. Among the NH(2)-terminal deletion constructs, mutant proteins starting with hydrophobic transmembrane segment (TMS) were localized to ER, but the ones containing the NH(2)-terminal hydrophilic cytosolic domain were not. ABC subfamily D proteins destined for peroxisomes have NH(2)-terminal hydrophilic region adjacent to TMS1. However, only P70R lacks the region and is translated with NH(2)-terminal hydrophobic TMS1. Furthermore, attachment of the NH(2)-terminal hydrophilic domain to the NH(2)-terminus of P70R excluded P70R from the ER-targeting pathway. These data suggest that P70R resides in the ER but not the peroxisomal membranes, and the hydrophobic property of NH(2)-terminal region determines the subcellular localization of ABC subfamily D proteins.
The National Institutes of Health Mammalian Gene Collection (MGC) Program is a multiinstitutional effort to identify and sequence a cDNA clone containing a complete ORF for each human and mouse gene. ESTs were generated from libraries enriched for full-length cDNAs and analyzed to identify candidate full-ORF clones, which then were sequenced to high accuracy. The MGC has currently sequenced and verified the full ORF for a nonredundant set of >9,000 human and >6,000 mouse genes. Candidate full-ORF clones for an additional 7,800 human and 3,500 mouse genes also have been identified. All MGC sequences and clones are available without restriction through public databases and clone distribution networks (see http:mgc.nci.nih.gov).