Abcd4 | GeneID:299196 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 299196 Official Symbol Abcd4
Locus N/A Gene Type protein-coding
Synonyms MGC105956; Pxmp1l
Full Name ATP-binding cassette, sub-family D (ALD), member 4
Description ATP-binding cassette, sub-family D (ALD), member 4
Chromosome 6q31
Also Known As ATP-binding cassette, sub-family D, member 4
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 3703

ID Symbol Protein Species
GeneID:5826 ABCD4 NP_005041.1 Homo sapiens
GeneID:19300 Abcd4 NP_033018.1 Mus musculus
GeneID:179968 pmp-3 NP_506620.1 Caenorhabditis elegans
GeneID:299196 Abcd4 XP_001061210.1 Rattus norvegicus
GeneID:423349 ABCD4 XP_421264.2 Gallus gallus
GeneID:453032 ABCD4 XP_001156286.1 Pan troglodytes
GeneID:490781 ABCD4 XP_547903.2 Canis lupus familiaris
GeneID:767748 zgc:153503 NP_001070185.1 Danio rerio
GeneID:841876 AT1G54350 NP_175837.2 Arabidopsis thaliana
GeneID:4324587 Os01g0218700 NP_001042413.1 Oryza sativa

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0016020 Component membrane
GO:0005886 Component plasma membrane
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001013100  UCSC Browser NP_001013118
2 XM_001059055  UCSC Browser XP_001059055
3 XM_001061210  UCSC Browser XP_001061210

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000016040 MI0001446 hsa-miR-424 CAGCAGCAAUUCAUGUUUUGAA
ENSRNOT00000016040 MI0003131 hsa-miR-492 AGGACCUGCGGGACAAGAUUCUU
ENSRNOT00000016040 MI0003180 hsa-miR-516a-3p UGCUUCCUUUCAGAGGGU
ENSRNOT00000016040 MI0003181 hsa-miR-516a-3p UGCUUCCUUUCAGAGGGU
ENSRNOT00000016040 MI0003159 hsa-miR-518c CAAAGCGCUUCUCUUUAGAGUGU
ENSRNOT00000016040 MI0003171 hsa-miR-518d-3p CAAAGCGCUUCCCUUUGGAGC
ENSRNOT00000016040 MI0003169 hsa-miR-518e AAAGCGCUUCCCUUCAGAGUG
ENSRNOT00000016040 MI0003150 hsa-miR-526b CUCUUGAGGGAAGCACUUUCUGU
ENSRNOT00000016040 MI0003567 hsa-miR-561 CAAAGUUUAAGAUCCUUGAAGU
ENSRNOT00000016040 MI0003580 hsa-miR-573 CUGAAGUGAUGUGUAACUGAUCAG
ENSRNOT00000016040 MI0003586 hsa-miR-579 UUCAUUUGGUAUAAACCGCGAUU
ENSRNOT00000016040 MI0003608 hsa-miR-596 AAGCCUGCCCGGCUCCUCGGG
ENSRNOT00000016040 MI0003625 hsa-miR-612 GCUGGGCAGGGCUUCUGAGCUCCUU
ENSRNOT00000016040 MI0003645 hsa-miR-631 AGACCUGGCCCAGACCUCAGC
ENSRNOT00000016040 MI0003652 hsa-miR-637 ACUGGGGGCUUUCGGGCUCUGCGU
ENSRNOT00000016040 MI0003664 hsa-miR-649 AAACCUGUGUUGUUCAAGAGUC
ENSRNOT00000016040 MI0005562 hsa-miR-887 GUGAACGGGCGCCAUCCCGAGG
ENSRNOT00000016040 MI0005538 hsa-miR-892b CACUGGCUCCUUUCUGGGUAGA
ENSRNOT00000016040 MI0005761 hsa-miR-939 UGGGGAGCUGAGGCUCUGGGGGUG
ENSRNOT00000016040 MI0000171 mmu-miR-149 UCUGGCUCCGUGUCUUCACUCCC
ENSRNOT00000016040 MI0005004 mmu-miR-615-5p GGGGGUCCCCGGUGCUCGGAUC
ENSRNOT00000016040 MI0004662 mmu-miR-693-3p GCAGCUUUCAGAUGUGGCUGUAA
ENSRNOT00000016040 MI0004689 mmu-miR-705 GGUGGGAGGUGGGGUGGGCA
ENSRNOT00000016040 MI0004124 mmu-miR-744 UGCGGGGCUAGGGCUAACAGCA
ENSRNOT00000016040 MI0000835 rno-let-7i* CUGCGCAAGCUACUGCCUUGCU
ENSRNOT00000016040 MI0000891 rno-miR-122 UGGAGUGUGACAAUGGUGUUUG
ENSRNOT00000016040 MI0000906 rno-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENSRNOT00000016040 MI0003490 rno-miR-133b UUUGGUCCCCUUCAACCAGCUA
ENSRNOT00000016040 MI0000932 rno-miR-187 UCGUGUCUUGUGUUGCAGCCGG
ENSRNOT00000016040 MI0000945 rno-miR-203 GUGAAAUGUUUAGGACCACUAG
ENSRNOT00000016040 MI0000851 rno-miR-22* AGUUCUUCAGUGGCAAGCUUUA
ENSRNOT00000016040 MI0000870 rno-miR-30a UGUAAACAUCCUCGACUGGAAG
ENSRNOT00000016040 MI0000868 rno-miR-30b-5p UGUAAACAUCCUACACUCAGCU
ENSRNOT00000016040 MI0000866 rno-miR-30c UGUAAACAUCCUACACUCUCAGC
ENSRNOT00000016040 MI0000871 rno-miR-30c UGUAAACAUCCUACACUCUCAGC
ENSRNOT00000016040 MI0000867 rno-miR-30e UGUAAACAUCCUUGACUGGAAG
ENSRNOT00000016040 MI0000600 rno-miR-327 CCUUGAGGGGCAUGAGGGU
ENSRNOT00000016040 MI0000626 rno-miR-342-5p AGGGGUGCUAUCUGUGAUUGAG
ENSRNOT00000016040 MI0000635 rno-miR-347 UGUCCCUCUGGGUCGCCCA
ENSRNOT00000016040 MI0006145 rno-miR-423 AGCUCGGUCUGAGGCCCCUCAGU
ENSRNOT00000016040 MI0001722 rno-miR-431 UGUCUUGCAGGCCGUCAUGCA
ENSRNOT00000016040 MI0006151 rno-miR-484 UCAGGCUCAGUCCCCUCCCGAU
ENSRNOT00000016040 MI0003555 rno-miR-503 UAGCAGCGGGAACAGUACUGCAG
ENSRNOT00000016040 MI0006155 rno-miR-598-3p UACGUCAUCGUCGUCAUCGUUA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Kashiwayama Y, et al. (2009) "70-kDa peroxisomal membrane protein related protein (P70R/ABCD4) localizes to endoplasmic reticulum not peroxisomes, and NH2-terminal hydrophobic property determines the subcellular localization of ABC subfamily D proteins." Exp Cell Res. 315(2):190-205. PMID:19010322
  2. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932