ABT1 | GeneID:29777 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 29777 Official Symbol ABT1
Locus N/A Gene Type protein-coding
Synonyms hABT1
Full Name activator of basal transcription 1
Description activator of basal transcription 1
Chromosome 6p22.1
Also Known As OTTHUMP00000017935; TATA-binding protein-binding protein; basal transcriptional activator
Summary Basal transcription of genes by RNA polymerase II requires the interaction of TATA-binding protein (TBP) with the core region of class II promoters. Studies in mouse suggest that the protein encoded by this gene likely activates basal transcription from class II promoters by interaction with TBP and the class II promoter DNA. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 6859

ID Symbol Protein Species
GeneID:29777 ABT1 NP_037507.1 Homo sapiens
GeneID:30946 Abt1 NP_038952.1 Mus musculus
GeneID:31837 CG6999 NP_572523.1 Drosophila melanogaster
GeneID:32344 CG10993 NP_572923.1 Drosophila melanogaster
GeneID:172368 F57B10.8 NP_491887.1 Caenorhabditis elegans
GeneID:306960 Abt1 XP_225368.3 Rattus norvegicus
GeneID:318160 CG32706 NP_727307.1 Drosophila melanogaster
GeneID:318161 CG32708 NP_727306.1 Drosophila melanogaster
GeneID:462499 ABT1 XP_001173335.1 Pan troglodytes
GeneID:488284 ABT1 XP_545406.2 Canis lupus familiaris
GeneID:539270 ABT1 NP_001069620.1 Bos taurus
GeneID:553568 zgc:109995 NP_001018383.1 Danio rerio
GeneID:824818 AT3G56510 NP_191210.2 Arabidopsis thaliana
GeneID:855790 ESF2 NP_014452.1 Saccharomyces cerevisiae
GeneID:2540503 esf2 NP_595758.1 Schizosaccharomyces pombe
GeneID:2684160 MGG_05815 XP_369649.1 Magnaporthe grisea
GeneID:2711695 NCU08668.1 XP_329792.1 Neurospora crassa
GeneID:2892281 KLLA0C18865g XP_453041.1 Kluyveromyces lactis
GeneID:3290889 AgaP_AGAP003737 XP_559505.1 Anopheles gambiae
GeneID:4344189 Os07g0662600 NP_001060544.1 Oryza sativa
GeneID:4619176 AGOS_ABR121C NP_983068.1 Eremothecium gossypii
GeneID:5740386 CG40813 NP_001104071.1 Drosophila melanogaster
GeneID:5740411 CG41562 NP_001104090.1 Drosophila melanogaster

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab28667 Activator of basal transcription 1 antibody (ab28667); Rabbit polyclonal to Activator of basal transcription 1
2 scbt ABT1 ABT1 Antibody / ABT1 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABT1 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABT1 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005730 Component nucleolus
GO:0005634 Component nucleus
GO:0005667 Component transcription factor complex
GO:0003677 Function DNA binding
GO:0016251 Function general RNA polymerase II transcription factor activity
GO:0003723 Function RNA binding
GO:0003713 Function transcription coactivator activity
GO:0006355 Process regulation of transcription, DNA-dependent
GO:0006350 Process transcription
GO:0006366 Process transcription from RNA polymerase II promoter

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_013375  UCSC Browser NP_037507

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000274849 MI0000060 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000274849 MI0000061 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000274849 MI0000062 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000274849 MI0000267 hsa-miR-10b UACCCUGUAGAACCGAAUUUGUG
ENST00000274849 MI0000474 hsa-miR-134 UGUGACUGGUUGACCAGAGGGG
ENST00000274849 MI0000460 hsa-miR-144 UACAGUAUAGAUGAUGUACU
ENST00000274849 MI0000072 hsa-miR-18a UAAGGUGCAUCUAGUGCAGAUAG
ENST00000274849 MI0000079 hsa-miR-23a AUCACAUUGCCAGGGAUUUCC
ENST00000274849 MI0000439 hsa-miR-23b AUCACAUUGCCAGGGAUUACC
ENST00000274849 MI0000825 hsa-miR-345 GCUGACUCCUAGUCCAGGGCUC
ENST00000274849 MI0003178 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENST00000274849 MI0003182 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENST00000274849 MI0003151 hsa-miR-519b-3p AAAGUGCAUCCUUUUAGAGGUU
ENST00000274849 MI0003148 hsa-miR-519c-3p AAAGUGCAUCUUUUUAGAGGAU
ENST00000274849 MI0003589 hsa-miR-582-3p UAACUGGUUGAACAACUGAACC
ENST00000274849 MI0000388 mmu-miR-290-5p ACUCAAACUAUGGGGGCACUUU
ENST00000274849 MI0004649 mmu-miR-685 UCAAUGGCUGAGGUGAGGCAC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen affects the expression of ABT1 mRNA
17562736

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Hepatitis, Toxic inferred via Acetaminophen 2444490, 17562736, 14986274, 17522070, 16081117, 16177239, 15968718, 16227642
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Andersen JS, et al. (2005) "Nucleolar proteome dynamics." Nature. 433(7021):77-83. PMID:15635413
  2. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  3. [ + ] Mungall AJ, et al. (2003) "The DNA sequence and analysis of human chromosome 6." Nature. 425(6960):805-811. PMID:14574404
  4. [ + ] Andersen JS, et al. (2002) "Directed proteomic analysis of the human nucleolus." Curr Biol. 12(1):1-11. PMID:11790298
  5. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  6. [ + ] Oda T, et al. (2000) "A novel TATA-binding protein-binding protein, ABT1, activates basal transcription and has a yeast homolog that is essential for growth." Mol Cell Biol. 20(4):1407-1418. PMID:10648625