Aadat | GeneID:29416 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 29416 Official Symbol Aadat
Locus N/A Gene Type protein-coding
Synonyms Kat2
Full Name aminoadipate aminotransferase
Description aminoadipate aminotransferase
Chromosome 16p12
Also Known As kynurenine aminotransferase 2; kynurenine aminotransferase II
Summary endogenous modulator of glutamatergic neurotransmission with kynurenine aminotransferase (KAT) activity [RGD]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 56540

ID Symbol Protein Species
GeneID:23923 Aadat NP_035964.1 Mus musculus
GeneID:29416 Aadat NP_058889.1 Rattus norvegicus
GeneID:51166 AADAT NP_057312.1 Homo sapiens
GeneID:428728 AADAT XP_426286.2 Gallus gallus
GeneID:461601 AADAT XP_001154960.1 Pan troglodytes
GeneID:486059 AADAT XP_543185.2 Canis lupus familiaris
GeneID:508929 AADAT NP_001015551.1 Bos taurus
GeneID:520638 LOC520638 XP_598886.3 Bos taurus
GeneID:557979 LOC557979 XP_686234.3 Danio rerio
GeneID:5048716 MGG_14221 XP_001402824.1 Magnaporthe grisea

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005829 Component cytosol
GO:0005739 Component mitochondrion
GO:0047536 Function 2-aminoadipate transaminase activity
GO:0016212 Function kynurenine-oxoglutarate transaminase activity
GO:0030170 Function pyridoxal phosphate binding
GO:0008483 Function transaminase activity
GO:0009058 Process biosynthetic process
GO:0019441 Process tryptophan catabolic process to kynurenine

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_017193  UCSC Browser NP_058889

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000015974 MI0003164 hsa-miR-520d-5p CUACAAAGGGAAGCCCUUUC
ENSRNOT00000015974 MI0003612 hsa-miR-548a-5p AAAAGUAAUUGCGAGUUUUACC
ENSRNOT00000015974 MI0003596 hsa-miR-548b-5p AAAAGUAAUUGUGGUUUUGGCC
ENSRNOT00000015974 MI0003630 hsa-miR-548c-5p AAAAGUAAUUGCGGUUUUUGCC
ENSRNOT00000015974 MI0003668 hsa-miR-548d-3p CAAAAACCACAGUUUCUUUUGC
ENSRNOT00000015974 MI0003671 hsa-miR-548d-3p CAAAAACCACAGUUUCUUUUGC
ENSRNOT00000015974 MI0003668 hsa-miR-548d-5p AAAAGUAAUUGUGGUUUUUGCC
ENSRNOT00000015974 MI0003671 hsa-miR-548d-5p AAAAGUAAUUGUGGUUUUUGCC
ENSRNOT00000015974 MI0003558 hsa-miR-553 AAAACGGUGAGAUUUUGUUUU
ENSRNOT00000015974 MI0003637 hsa-miR-623 AUCCCUUGCAGGGGCUGUUGGGU
ENSRNOT00000015974 MI0003661 hsa-miR-646 AAGCAGCUGCCUCUGAGGC
ENSRNOT00000015974 MI0003664 hsa-miR-649 AAACCUGUGUUGUUCAAGAGUC
ENSRNOT00000015974 MI0005714 hsa-miR-922 GCAGCAGAGAAUAGGACUACGUC
ENSRNOT00000015974 MI0005715 hsa-miR-923 GUCAGCGGAGGAAAAGAAACU
ENSRNOT00000015974 MI0000177 mmu-miR-155 UUAAUGCUAAUUGUGAUAGGGGU
ENSRNOT00000015974 MI0004634 mmu-miR-677 UUCAGUGAUGAUUAGCUUCUGA
ENSRNOT00000015974 MI0005204 mmu-miR-805 GAAUUGAUCAGGACAUAGGG
ENSRNOT00000015974 MI0000637 rno-miR-129 CUUUUUGCGGUCUGGGCUUGC
ENSRNOT00000015974 MI0000902 rno-miR-129 CUUUUUGCGGUCUGGGCUUGC
ENSRNOT00000015974 MI0000915 rno-miR-142-5p CAUAAAGUAGAAAGCACUACU
ENSRNOT00000015974 MI0000845 rno-miR-17-3p ACUGCAGUGAAGGCACUUGUGG
ENSRNOT00000015974 MI0006133 rno-miR-182 UUUGGCAAUGGUAGAACUCACACCG
ENSRNOT00000015974 MI0000940 rno-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENSRNOT00000015974 MI0001152 rno-miR-196b UAGGUAGUUUCCUGUUGUUGGG
ENSRNOT00000015974 MI0006136 rno-miR-196c UAGGUAGUUUCGUGUUGUUGGG
ENSRNOT00000015974 MI0000959 rno-miR-219-5p UGAUUGUCCAAACGCAAUUCU
ENSRNOT00000015974 MI0000960 rno-miR-219-5p UGAUUGUCCAAACGCAAUUCU
ENSRNOT00000015974 MI0000965 rno-miR-291a-5p CAUCAAAGUGGAGGCCCUCUCU
ENSRNOT00000015974 MI0000873 rno-miR-32 UAUUGCACAUUACUAAGUUGCA
ENSRNOT00000015974 MI0000596 rno-miR-325-3p UUUAUUGAGCACCUCCUAUCAA
ENSRNOT00000015974 MI0000596 rno-miR-325-5p CCUAGUAGGUGCUCAGUAAGUGU
ENSRNOT00000015974 MI0000639 rno-miR-350 UUCACAAAGCCCAUACACUUUCAC
ENSRNOT00000015974 MI0003481 rno-miR-361 UUAUCAGAAUCUCCAGGGGUAC
ENSRNOT00000015974 MI0001656 rno-miR-365 UAAUGCCCCUAAAAAUCCUUAU
ENSRNOT00000015974 MI0006140 rno-miR-375 UUUGUUCGUUCGGCUCGCGUGA
ENSRNOT00000015974 MI0003545 rno-miR-376a AUCGUAGAGGAAAAUCCACGU
ENSRNOT00000015974 MI0003548 rno-miR-382 GAAGUUGUUCGUGGUGGAUUCG
ENSRNOT00000015974 MI0003478 rno-miR-383 AGAUCAGAAGGUGACUGUGGCU
ENSRNOT00000015974 MI0001639 rno-miR-448 UUGCAUAUGUAGGAUGUCCCAU
ENSRNOT00000015974 MI0001654 rno-miR-450a UUUUUGCGAUGUGUUCCUAAUG
ENSRNOT00000015974 MI0003525 rno-miR-543 AAGUUGCCCGCGUGUUUUUCGC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

BC078864   NM_017193   Z50144  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Guidetti P, et al. (2007) "Astrocytic localization of kynurenine aminotransferase II in the rat brain visualized by immunocytochemistry." Glia. 55(1):78-92. PMID:17024659
  2. [ + ] Rzeski W, et al. (2005) "Demonstration of kynurenine aminotransferases I and II and characterization of kynurenic acid synthesis in cultured cerebral cortical neurons." J Neurosci Res. 80(5):677-682. PMID:15880762
  3. [ + ] Wejksza K, et al. (2005) "Demonstration of kynurenine aminotransferases I and II and characterization of kynurenic acid synthesis in oligodendrocyte cell line (OLN-93)." Neurochem Res. 30(8):963-968. PMID:16258845
  4. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  5. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  6. [ + ] Buchli R, et al. (1995) "Cloning and functional expression of a soluble form of kynurenine/alpha-aminoadipate aminotransferase from rat kidney." J Biol Chem. 270(49):29330-29335. PMID:7493966
  7. [ + ] Okayama A, et al. (1988) "Enzymatic studies on tryptophan metabolism disorder in rats chronically exposed to carbon disulfide." Toxicol Appl Pharmacol. 94(3):356-361. PMID:3400092
  8. [ + ] Takeuchi F, et al. (1984) "Kynurenine metabolism in vitamin-B-6-deficient rat liver after tryptophan injection." Biochem J. 220(3):693-699. PMID:6466295