Abca16 | GeneID:293444 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 293444 Official Symbol Abca16
Locus N/A Gene Type protein-coding
Synonyms RGD1563534
Full Name ATP-binding cassette, sub-family A (ABC1), member 16
Description ATP-binding cassette, sub-family A (ABC1), member 16
Chromosome 1q35
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 66153

ID Symbol Protein Species
GeneID:233810 Abca16 NP_997013.1 Mus musculus
GeneID:293444 Abca16 XP_219281.4 Rattus norvegicus
GeneID:479816 LOC479816 XP_536943.2 Canis lupus familiaris

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_001079201  UCSC Browser XP_001079201
2 XM_219281  UCSC Browser XP_219281

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000001933 MI0003197 hsa-miR-510 UACUCAGGAGAGUGGCAAUCAC
ENSRNOT00000001933 MI0003562 hsa-miR-556-5p GAUGAGCUCAUUGUAAUAUGAG
ENSRNOT00000001933 MI0003648 hsa-miR-633 CUAAUAGUAUCUACCACAAUAAA
ENSRNOT00000001933 MI0005713 hsa-miR-921 CUAGUGAGGGACAGAACCAGGAUUC
ENSRNOT00000001933 MI0006128 mmu-miR-467e AUAAGUGUGAGCAUGUAUAUGU
ENSRNOT00000001933 MI0005557 mmu-miR-653 GUGUUGAAACAAUCUCUACUG
ENSRNOT00000001933 MI0004123 mmu-miR-675-5p UGGUGCGGAAAGGGCCCACAGU
ENSRNOT00000001933 MI0000941 rno-miR-199a-5p CCCAGUGUUCAGACUACCUGUUC
ENSRNOT00000001933 MI0000871 rno-miR-30c-2* CUGGGAGAAGGCUGUUUACUCU
ENSRNOT00000001933 MI0003544 rno-miR-376b-3p AUCAUAGAGGAACAUCCACUU
ENSRNOT00000001933 MI0003527 rno-miR-541 AAGGGAUUCUGAUGUUGGUCACACU
ENSRNOT00000001933 MI0000838 rno-miR-9* AUAAAGCUAGAUAACCGAAAGU
ENSRNOT00000001933 MI0000839 rno-miR-9* AUAAAGCUAGAUAACCGAAAGU
ENSRNOT00000001933 MI0000840 rno-miR-9* AUAAAGCUAGAUAACCGAAAGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene