Abca15 | GeneID:293442 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 293442 Official Symbol Abca15
Locus N/A Gene Type protein-coding
Synonyms
Full Name ATP-binding cassette, sub-family A (ABC1), member 15
Description ATP-binding cassette, sub-family A (ABC1), member 15
Chromosome 1q35
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 87255

ID Symbol Protein Species
GeneID:293442 Abca15 XP_219276.4 Rattus norvegicus
GeneID:320631 Abca15 NP_796187.2 Mus musculus
GeneID:479817 LOC479817 XP_536944.2 Canis lupus familiaris

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005575 Component cellular_component
GO:0003674 Function molecular_function
GO:0008150 Process biological_process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001106293  UCSC Browser NP_001099763
2 XM_001075753  UCSC Browser XP_001075753
3 XM_219276  UCSC Browser XP_219276

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000037026 MI0000780 hsa-miR-372 AAAGUGCUGCGACAUUUGAGCGU
ENSRNOT00000037026 MI0003186 hsa-miR-502-5p AUCCUUGCUAUCUGGGUGCUA
ENSRNOT00000037026 MI0003613 hsa-miR-600 ACUUACAGACAAGAGCCUUGCUC
ENSRNOT00000037026 MI0003763 hsa-miR-767-5p UGCACCAUGGUUGUCUGAGCAUG
ENSRNOT00000037026 MI0003716 mmu-miR-302b UAAGUGCUUCCAUGUUUUAGUAG
ENSRNOT00000037026 MI0003718 mmu-miR-302d UAAGUGCUUCCAUGUUUGAGUGU
ENSRNOT00000037026 MI0004685 mmu-miR-701 UUAGCCGCUGAAAUAGAUGGA
ENSRNOT00000037026 MI0004690 mmu-miR-706 AGAGAAACCCUGUCUCAAAAAA
ENSRNOT00000037026 MI0000928 rno-miR-183 UAUGGCACUGGUAGAAUUCACU
ENSRNOT00000037026 MI0000942 rno-miR-200c UAAUACUGCCGGGUAAUGAUGG
ENSRNOT00000037026 MI0000955 rno-miR-216a UAAUCUCAGCUGGCAACUGUGA
ENSRNOT00000037026 MI0000876 rno-miR-34c* AAUCACUAACCACACAGCCAGG
ENSRNOT00000037026 MI0003551 rno-miR-369-3p AAUAAUACAUGGUUGAUCUUU
ENSRNOT00000037026 MI0001643 rno-miR-429 UAAUACUGUCUGGUAAUGCCGU
ENSRNOT00000037026 MI0006169 rno-miR-652 AAUGGCGCCACUAGGGUUGUG
ENSRNOT00000037026 MI0006122 rno-miR-880 UACUCCAUUCAUUCUGAGUAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene