Aars | GeneID:292023 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 292023 Official Symbol Aars
Locus N/A Gene Type protein-coding
Synonyms
Full Name alanyl-tRNA synthetase
Description alanyl-tRNA synthetase
Chromosome 19q12
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 1213

ID Symbol Protein Species
GeneID:16 AARS NP_001596.2 Homo sapiens
GeneID:34156 Aats-ala NP_523511.2 Drosophila melanogaster
GeneID:171985 ars-2 NP_491281.1 Caenorhabditis elegans
GeneID:234734 Aars NP_666329.2 Mus musculus
GeneID:292023 Aars XP_214690.3 Rattus norvegicus
GeneID:324940 aars NP_001037775.1 Danio rerio
GeneID:415668 AARS NP_001005836.1 Gallus gallus
GeneID:454210 AARS XP_001169474.1 Pan troglodytes
GeneID:479656 AARS XP_536788.2 Canis lupus familiaris
GeneID:510933 AARS XP_588170.3 Bos taurus
GeneID:814313 PF13_0354 XP_001350388.1 Plasmodium falciparum
GeneID:841442 ALATS NP_175439.2 Arabidopsis thaliana
GeneID:854513 ALA1 NP_014980.1 Saccharomyces cerevisiae
GeneID:1279087 AgaP_AGAP009701 XP_318757.2 Anopheles gambiae
GeneID:2542031 SPAC23C11.09 NP_593640.1 Schizosaccharomyces pombe
GeneID:2676649 MGG_03607 XP_361064.2 Magnaporthe grisea
GeneID:2713811 NCU02566.1 XP_331765.1 Neurospora crassa
GeneID:2894909 KLLA0F02431g XP_455190.1 Kluyveromyces lactis
GeneID:4348211 Os10g0182000 NP_001064254.1 Oryza sativa
GeneID:4620624 AGOS_ADR363C NP_984459.1 Eremothecium gossypii

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0004813 Function alanine-tRNA ligase activity
GO:0016597 Function amino acid binding
GO:0005524 Function ATP binding
GO:0016874 Function ligase activity
GO:0003676 Function nucleic acid binding
GO:0000166 Function nucleotide binding
GO:0000049 Function tRNA binding
GO:0006419 Process alanyl-tRNA aminoacylation
GO:0034620 Process cellular response to unfolded protein
GO:0021680 Process cerebellar Purkinje cell layer development
GO:0030968 Process endoplasmic reticulum unfolded protein response
GO:0001942 Process hair follicle development
GO:0043524 Process negative regulation of neuron apoptosis
GO:0050905 Process neuromuscular process
GO:0050885 Process neuromuscular process controlling balance
GO:0006457 Process protein folding
GO:0043200 Process response to amino acid stimulus
GO:0043588 Process skin development
GO:0006412 Process translation
GO:0043039 Process tRNA aminoacylation
GO:0006400 Process tRNA modification

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001100517  UCSC Browser NP_001093987
2 XM_001077503  UCSC Browser XP_001077503
3 XM_214690  UCSC Browser XP_214690

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000025052 MI0003186 hsa-miR-502-3p AAUGCACCUGGGCAAGGAUUCA
ENSRNOT00000025052 MI0003180 hsa-miR-516a-3p UGCUUCCUUUCAGAGGGU
ENSRNOT00000025052 MI0003181 hsa-miR-516a-3p UGCUUCCUUUCAGAGGGU
ENSRNOT00000025052 MI0003160 hsa-miR-524-3p GAAGGCGCUUCCCUUUGGAGU
ENSRNOT00000025052 MI0003152 hsa-miR-525-3p GAAGGCGCUUCCCUUUAGAGCG
ENSRNOT00000025052 MI0003631 hsa-miR-617 AGACUUCCCAUUUGAAGGUGGC
ENSRNOT00000025052 MI0003633 hsa-miR-619 GACCUGGACAUGUUUGUGCCCAGU
ENSRNOT00000025052 MI0003642 hsa-miR-628-5p AUGCUGACAUAUUUACUAGAGG
ENSRNOT00000025052 MI0003645 hsa-miR-631 AGACCUGGCCCAGACCUCAGC
ENSRNOT00000025052 MI0003653 hsa-miR-638 AGGGAUCGCGGGCGGGUGGCGGCCU
ENSRNOT00000025052 MI0003660 hsa-miR-645 UCUAGGCUGGUACUGCUGA
ENSRNOT00000025052 MI0003670 hsa-miR-662 UCCCACGUUGUGGCCCAGCAG
ENSRNOT00000025052 MI0003672 hsa-miR-663 AGGCGGGGCGCCGCGGGACCGC
ENSRNOT00000025052 MI0005537 hsa-miR-888 UACUCAAAAAGCUGUCAGUCA
ENSRNOT00000025052 MI0005757 hsa-miR-935 CCAGUUACCGCUUCCGCUACCGC
ENSRNOT00000025052 MI0002400 mmu-miR-465a-3p GAUCAGGGCCUUUCUAAGUAGA
ENSRNOT00000025052 MI0002400 mmu-miR-465a-5p UAUUUAGAAUGGCACUGAUGUGA
ENSRNOT00000025052 MI0005498 mmu-miR-465b-5p UAUUUAGAAUGGUGCUGAUCUG
ENSRNOT00000025052 MI0005499 mmu-miR-465b-5p UAUUUAGAAUGGUGCUGAUCUG
ENSRNOT00000025052 MI0005500 mmu-miR-465c-5p UAUUUAGAAUGGCGCUGAUCUG
ENSRNOT00000025052 MI0005501 mmu-miR-465c-5p UAUUUAGAAUGGCGCUGAUCUG
ENSRNOT00000025052 MI0002403 mmu-miR-468 UAUGACUGAUGUGCGUGUGUCUG
ENSRNOT00000025052 MI0003493 mmu-miR-486 UCCUGUACUGAGCUGCCCCGAG
ENSRNOT00000025052 MI0005555 mmu-miR-544 AUUCUGCAUUUUUAGCAAGCUC
ENSRNOT00000025052 MI0005004 mmu-miR-615-5p GGGGGUCCCCGGUGCUCGGAUC
ENSRNOT00000025052 MI0004554 mmu-miR-759 GCAGAGUGCAAACAAUUUUGAC
ENSRNOT00000025052 MI0000637 rno-miR-129 CUUUUUGCGGUCUGGGCUUGC
ENSRNOT00000025052 MI0000902 rno-miR-129 CUUUUUGCGGUCUGGGCUUGC
ENSRNOT00000025052 MI0000907 rno-miR-134 UGUGACUGGUUGACCAGAGGGG
ENSRNOT00000025052 MI0000911 rno-miR-138 AGCUGGUGUUGUGAAUCAGGCCG
ENSRNOT00000025052 MI0000912 rno-miR-138 AGCUGGUGUUGUGAAUCAGGCCG
ENSRNOT00000025052 MI0000918 rno-miR-145 GUCCAGUUUUCCCAGGAAUCCCU
ENSRNOT00000025052 MI0000845 rno-miR-17-3p ACUGCAGUGAAGGCACUUGUGG
ENSRNOT00000025052 MI0000929 rno-miR-184 UGGACGGAGAACUGAUAAGGGU
ENSRNOT00000025052 MI0000940 rno-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENSRNOT00000025052 MI0001152 rno-miR-196b UAGGUAGUUUCCUGUUGUUGGG
ENSRNOT00000025052 MI0006136 rno-miR-196c UAGGUAGUUUCGUGUUGUUGGG
ENSRNOT00000025052 MI0000942 rno-miR-200c UAAUACUGCCGGGUAAUGAUGG
ENSRNOT00000025052 MI0003554 rno-miR-20b-3p ACUGCAGUGUGAGCACUUCUGG
ENSRNOT00000025052 MI0000956 rno-miR-217 UACUGCAUCAGGAACUGACUGGAU
ENSRNOT00000025052 MI0000854 rno-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENSRNOT00000025052 MI0000855 rno-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENSRNOT00000025052 MI0000967 rno-miR-296 GAGGGUUGGGUGGAGGCUCUCC
ENSRNOT00000025052 MI0000969 rno-miR-298 GGCAGAGGAGGGCUGUUCUUCCC
ENSRNOT00000025052 MI0000629 rno-miR-344-3p UGAUCUAGCCAAAGCCUGACCGU
ENSRNOT00000025052 MI0000629 rno-miR-344-5p UCAGGCUCCUGGCUAGAUUCCAGG
ENSRNOT00000025052 MI0000631 rno-miR-345-3p CCCUGAACUAGGGGUCUGGAGA
ENSRNOT00000025052 MI0001423 rno-miR-421 GGCCUCAUUAAAUGUUUGUUG
ENSRNOT00000025052 MI0001650 rno-miR-449a UGGCAGUGUAUUGUUAGCUGGU
ENSRNOT00000025052 MI0003721 rno-miR-499 UUAAGACUUGCAGUGAUGUUU
ENSRNOT00000025052 MI0006153 rno-miR-500 AAUGCACCUGGGCAAGGGUUCA
ENSRNOT00000025052 MI0003528 rno-miR-542-5p CUCGGGGAUCAUCAUGUCACGA
ENSRNOT00000025052 MI0006169 rno-miR-652 AAUGGCGCCACUAGGGUUGUG
ENSRNOT00000025052 MI0006159 rno-miR-674-3p CACAGCUCCCAUCUCAGAACAA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  2. [ + ] Dignam JD, et al. (1991) "Alanyl-tRNA synthetase from Escherichia coli, Bombyx mori and Ratus ratus. Existence of common structural features." Eur J Biochem. 198(1):201-210. PMID:2040280