Abcc12 | GeneID:291923 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 291923 Official Symbol Abcc12
Locus N/A Gene Type protein-coding
Synonyms
Full Name ATP-binding cassette, sub-family C (CFTR/MRP), member 12
Description ATP-binding cassette, sub-family C (CFTR/MRP), member 12
Chromosome 19p11
Also Known As ATP-binding cassette protein C12 variant A
Summary member of the ATP-binding cassette (ABC) transporter family; human homolog is a candidate disease gene for paroxysmal kinesigenic choreoathetosis [RGD]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 57211

ID Symbol Protein Species
GeneID:94160 ABCC12 NP_150229.2 Homo sapiens
GeneID:244562 Abcc12 NP_766500.3 Mus musculus
GeneID:291923 Abcc12 NP_955409.1 Rattus norvegicus
GeneID:487294 ABCC12 XP_544420.2 Canis lupus familiaris
GeneID:568482 LOC568482 XP_696904.3 Danio rerio
GeneID:745745 ABCC12 XP_001163361.1 Pan troglodytes

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_199377  UCSC Browser NP_955409

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000021095 MI0000779 hsa-miR-371-5p ACUCAAACUGUGGGGGCACU
ENSRNOT00000021095 MI0003140 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENSRNOT00000021095 MI0003141 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENSRNOT00000021095 MI0003180 hsa-miR-516a-5p UUCUCGAGGAAAGAAGCACUUUC
ENSRNOT00000021095 MI0003181 hsa-miR-516a-5p UUCUCGAGGAAAGAAGCACUUUC
ENSRNOT00000021095 MI0003559 hsa-miR-554 GCUAGUCCUGACUCAGCCAGU
ENSRNOT00000021095 MI0003561 hsa-miR-555 AGGGUAAGCUGAACCUCUGAU
ENSRNOT00000021095 MI0003603 hsa-miR-591 AGACCAUGGGUUCUCAUUGU
ENSRNOT00000021095 MI0003624 hsa-miR-611 GCGAGGACCCCUCGGGGUCUGAC
ENSRNOT00000021095 MI0003626 hsa-miR-613 AGGAAUGUUCCUUCUUUGCC
ENSRNOT00000021095 MI0003636 hsa-miR-622 ACAGUCUGCUGAGGUUGGAGC
ENSRNOT00000021095 MI0003641 hsa-miR-627 GUGAGUCUCUAAGAAAAGAGGA
ENSRNOT00000021095 MI0003650 hsa-miR-635 ACUUGGGCACUGAAACAAUGUCC
ENSRNOT00000021095 MI0003836 hsa-miR-766 ACUCCAGCCCCACAGCCUCAGC
ENSRNOT00000021095 MI0005498 mmu-miR-465b-5p UAUUUAGAAUGGUGCUGAUCUG
ENSRNOT00000021095 MI0005499 mmu-miR-465b-5p UAUUUAGAAUGGUGCUGAUCUG
ENSRNOT00000021095 MI0005500 mmu-miR-465c-5p UAUUUAGAAUGGCGCUGAUCUG
ENSRNOT00000021095 MI0005501 mmu-miR-465c-5p UAUUUAGAAUGGCGCUGAUCUG
ENSRNOT00000021095 MI0004589 mmu-miR-496 UGAGUAUUACAUGGCCAAUCUC
ENSRNOT00000021095 MI0005515 mmu-miR-504 AGACCCUGGUCUGCACUCUAUC
ENSRNOT00000021095 MI0004171 mmu-miR-665 ACCAGGAGGCUGAGGUCCCU
ENSRNOT00000021095 MI0004666 mmu-miR-669b AGUUUUGUGUGCAUGUGCAUGU
ENSRNOT00000021095 MI0004638 mmu-miR-679 GGACUGUGAGGUGACUCUUGGU
ENSRNOT00000021095 MI0004682 mmu-miR-698 CAUUCUCGUUUCCUUCCCU
ENSRNOT00000021095 MI0004688 mmu-miR-704 AGACAUGUGCUCUGCUCCUAG
ENSRNOT00000021095 MI0004689 mmu-miR-705 GGUGGGAGGUGGGGUGGGCA
ENSRNOT00000021095 MI0004651 mmu-miR-719 AUCUCGGCUACAGAAAAAUGUU
ENSRNOT00000021095 MI0005204 mmu-miR-805 GAAUUGAUCAGGACAUAGGG
ENSRNOT00000021095 MI0000841 rno-miR-10a-5p UACCCUGUAGAUCCGAAUUUGUG
ENSRNOT00000021095 MI0000910 rno-miR-137 UUAUUGCUUAAGAAUACGCGUAG
ENSRNOT00000021095 MI0000647 rno-miR-151 UCGAGGAGCUCACAGUCUAGU
ENSRNOT00000021095 MI0000926 rno-miR-181b AACAUUCAUUGCUGUCGGUGGGU
ENSRNOT00000021095 MI0000927 rno-miR-181b AACAUUCAUUGCUGUCGGUGGGU
ENSRNOT00000021095 MI0006132 rno-miR-181d AACAUUCAUUGUUGUCGGUGGGU
ENSRNOT00000021095 MI0000929 rno-miR-184 UGGACGGAGAACUGAUAAGGGU
ENSRNOT00000021095 MI0001152 rno-miR-196b UAGGUAGUUUCCUGUUGUUGGG
ENSRNOT00000021095 MI0003479 rno-miR-207 GCUUCUCCUGGCUCUCCUCCCUU
ENSRNOT00000021095 MI0000964 rno-miR-290 CUCAAACUAUGGGGGCACUUUUU
ENSRNOT00000021095 MI0000966 rno-miR-292-5p ACUCAAACUGGGGGCUCUUUUG
ENSRNOT00000021095 MI0000622 rno-miR-340-3p UCCGUCUCAGUUACUUUAUAGCC
ENSRNOT00000021095 MI0000626 rno-miR-342-3p UCUCACACAGAAAUCGCACCCGU
ENSRNOT00000021095 MI0000633 rno-miR-346 UGUCUGCCUGAGUGCCUGCCUCU
ENSRNOT00000021095 MI0003478 rno-miR-383 AGAUCAGAAGGUGACUGUGGCU
ENSRNOT00000021095 MI0003488 rno-miR-412 ACUUCACCUGGUCCACUAGCCGU
ENSRNOT00000021095 MI0006147 rno-miR-434 UUUGAACCAUCACUCGACUCCU
ENSRNOT00000021095 MI0003722 rno-miR-664 UAUUCAUUUACUCCCCAGCCUA
ENSRNOT00000021095 MI0003723 rno-miR-664 UAUUCAUUUACUCCCCAGCCUA
ENSRNOT00000021095 MI0006156 rno-miR-671 UCCGGUUCUCAGGGCUCCACC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Shimizu H, et al. (2003) "Characterization of the mouse Abcc12 gene and its transcript encoding an ATP-binding cassette transporter, an orthologue of human ABCC12." Gene. 310():17-28. PMID:12801629