A2ld1 | GeneID:290500 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 290500 Official Symbol A2ld1
Locus N/A Gene Type protein-coding
Synonyms MGC112665; RGD1304748
Full Name AIG2-like domain 1
Description AIG2-like domain 1
Chromosome 15q25
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 15522

ID Symbol Protein Species
GeneID:37989 Tina-1 NP_611983.2 Drosophila melanogaster
GeneID:87769 A2LD1 XP_001714550.1 Homo sapiens
GeneID:223267 a2ld1 NP_663441.1 Mus musculus
GeneID:290500 A2ld1 NP_001020805.1 Rattus norvegicus
GeneID:418773 A2LD1 XP_416969.1 Gallus gallus
GeneID:447805 zgc:92115 NP_001004544.1 Danio rerio
GeneID:485534 A2LD1 XP_542653.2 Canis lupus familiaris
GeneID:777609 zgc:154024 NP_001071185.1 Danio rerio
GeneID:100038780 zgc:162208 NP_001083029.1 Danio rerio

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001025634  UCSC Browser NP_001020805

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000019158 MI0005023 bta-miR-545 AUCAACAAACAUUUAUUGUGUG
ENSRNOT00000019158 MI0003194 hsa-miR-507 UUUUGCACCUUUUGGAGUGAA
ENSRNOT00000019158 MI0003140 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENSRNOT00000019158 MI0003141 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENSRNOT00000019158 MI0003587 hsa-miR-580 UUGAGAAUGAUGAAUCAUUAGG
ENSRNOT00000019158 MI0003591 hsa-miR-584 UUAUGGUUUGCCUGGGACUGAG
ENSRNOT00000019158 MI0002399 mmu-miR-464 UACCAAGUUUAUUCUGUGAGAUA
ENSRNOT00000019158 MI0005498 mmu-miR-465b-5p UAUUUAGAAUGGUGCUGAUCUG
ENSRNOT00000019158 MI0005499 mmu-miR-465b-5p UAUUUAGAAUGGUGCUGAUCUG
ENSRNOT00000019158 MI0000896 rno-miR-125b-3p ACGGGUUAGGCUCUUGGGAGCU
ENSRNOT00000019158 MI0000845 rno-miR-17-3p ACUGCAGUGAAGGCACUUGUGG
ENSRNOT00000019158 MI0000933 rno-miR-190 UGAUAUGUUUGAUAUAUUAGGU
ENSRNOT00000019158 MI0000940 rno-miR-196a* UCGGCAACAAGAAACUGCCUGA
ENSRNOT00000019158 MI0000850 rno-miR-21* CAACAGCAGUCGAUGGGCUGUC
ENSRNOT00000019158 MI0000856 rno-miR-25* AGGCGGAGACACGGGCAAUUGC
ENSRNOT00000019158 MI0000969 rno-miR-298 GGCAGAGGAGGGCUGUUCUUCCC
ENSRNOT00000019158 MI0000866 rno-miR-30c-1* CUGGGAGAGGGUUGUUUACUCC
ENSRNOT00000019158 MI0000871 rno-miR-30c-2* CUGGGAGAAGGCUGUUUACUCU
ENSRNOT00000019158 MI0006150 rno-miR-471 UACGUAGUAUAGUGCUUUUCAC
ENSRNOT00000019158 MI0006162 rno-miR-743a GAAAGACGCCAAACUGGGUAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932