Abcf3 | GeneID:287982 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 287982 Official Symbol Abcf3
Locus N/A Gene Type protein-coding
Synonyms
Full Name ATP-binding cassette, sub-family F (GCN20), member 3
Description ATP-binding cassette, sub-family F (GCN20), member 3
Chromosome 11q23
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 22784

ID Symbol Protein Species
GeneID:27406 Abcf3 NP_038880.1 Mus musculus
GeneID:40131 CG9330 NP_649129.1 Drosophila melanogaster
GeneID:55324 ABCF3 NP_060828.2 Homo sapiens
GeneID:175873 abcf-3 NP_498339.1 Caenorhabditis elegans
GeneID:287982 Abcf3 NP_001011896.1 Rattus norvegicus
GeneID:424950 ABCF3 XP_422757.2 Gallus gallus
GeneID:460884 ABCF3 XP_516910.2 Pan troglodytes
GeneID:478651 ABCF3 XP_859024.1 Canis lupus familiaris
GeneID:530975 ABCF3 XP_001252189.1 Bos taurus
GeneID:842763 ATGCN3 NP_176636.1 Arabidopsis thaliana
GeneID:850561 GCN20 NP_116664.1 Saccharomyces cerevisiae
GeneID:1267735 ENSANGG00000000043 XP_306294.2 Anopheles gambiae
GeneID:1280669 AgaP_AGAP012005 XP_320530.2 Anopheles gambiae
GeneID:2540597 SPBC29A3.09c NP_595837.1 Schizosaccharomyces pombe
GeneID:2705213 NCU04051.1 XP_323370.1 Neurospora crassa
GeneID:2896717 KLLA0A10857g XP_451473.1 Kluyveromyces lactis
GeneID:4331217 Os02g0826500 NP_001048587.1 Oryza sativa
GeneID:4621026 AGOS_AEL032W NP_984829.1 Eremothecium gossypii
GeneID:5050704 MGG_11547 XP_001411010.1 Magnaporthe grisea
GeneID:100149614 LOC100149614 XP_001922895.1 Danio rerio

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001011896  UCSC Browser NP_001011896

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000002327 MI0004997 gga-miR-456 CAGGCUGGUUAGAUGGUUGUCA
ENSRNOT00000002327 MI0004998 gga-miR-460 CCUGCAUUGUACACACUGUGUG
ENSRNOT00000002327 MI0003133 hsa-miR-432 UCUUGGAGUAGGUCAUUGGGUGG
ENSRNOT00000002327 MI0003195 hsa-miR-508-5p UACUCCAGAGGGCGUCACUCAUG
ENSRNOT00000002327 MI0003140 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENSRNOT00000002327 MI0003141 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENSRNOT00000002327 MI0003170 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENSRNOT00000002327 MI0003173 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENSRNOT00000002327 MI0003630 hsa-miR-548c-3p CAAAAAUCUCAAUUACUUUUGC
ENSRNOT00000002327 MI0003668 hsa-miR-548d-3p CAAAAACCACAGUUUCUUUUGC
ENSRNOT00000002327 MI0003671 hsa-miR-548d-3p CAAAAACCACAGUUUCUUUUGC
ENSRNOT00000002327 MI0003559 hsa-miR-554 GCUAGUCCUGACUCAGCCAGU
ENSRNOT00000002327 MI0003570 hsa-miR-564 AGGCACGGUGUCAGCAGGC
ENSRNOT00000002327 MI0003578 hsa-miR-571 UGAGUUGGCCAUCUGAGUGAG
ENSRNOT00000002327 MI0003599 hsa-miR-589 UGAGAACCACGUCUGCUCUGAG
ENSRNOT00000002327 MI0003618 hsa-miR-605 UAAAUCCCAUGGUGCCUUCUCCU
ENSRNOT00000002327 MI0003625 hsa-miR-612 GCUGGGCAGGGCUUCUGAGCUCCUU
ENSRNOT00000002327 MI0003633 hsa-miR-619 GACCUGGACAUGUUUGUGCCCAGU
ENSRNOT00000002327 MI0003637 hsa-miR-623 AUCCCUUGCAGGGGCUGUUGGGU
ENSRNOT00000002327 MI0003639 hsa-miR-625 AGGGGGAAAGUUCUAUAGUCC
ENSRNOT00000002327 MI0003640 hsa-miR-626 AGCUGUCUGAAAAUGUCUU
ENSRNOT00000002327 MI0003658 hsa-miR-643 ACUUGUAUGCUAGCUCAGGUAG
ENSRNOT00000002327 MI0003661 hsa-miR-646 AAGCAGCUGCCUCUGAGGC
ENSRNOT00000002327 MI0003670 hsa-miR-662 UCCCACGUUGUGGCCCAGCAG
ENSRNOT00000002327 MI0002637 mml-miR-189 GUGCCUACUGAGCUGAUAUCAGU
ENSRNOT00000002327 MI0000244 mmu-miR-201 UACUCAGUAAGGCAUUGUUCUU
ENSRNOT00000002327 MI0000245 mmu-miR-202-5p UUCCUAUGCAUAUACUUCUUU
ENSRNOT00000002327 MI0005497 mmu-miR-453 AGGUUGCCUCAUAGUGAGCUUGCA
ENSRNOT00000002327 MI0005002 mmu-miR-490 CAACCUGGAGGACUCCAUGCUG
ENSRNOT00000002327 MI0004680 mmu-miR-491 AGUGGGGAACCCUUCCAUGAGG
ENSRNOT00000002327 MI0005516 mmu-miR-509-5p UACUCCAGAAUGUGGCAAUCAU
ENSRNOT00000002327 MI0003517 mmu-miR-546 AUGGUGGCACGGAGUC
ENSRNOT00000002327 MI0004171 mmu-miR-665 ACCAGGAGGCUGAGGUCCCU
ENSRNOT00000002327 MI0004644 mmu-miR-682 CUGCAGUCACAGUGAAGUCUG
ENSRNOT00000002327 MI0004654 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENSRNOT00000002327 MI0004655 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENSRNOT00000002327 MI0004683 mmu-miR-699 AGGCAGUGCGACCUGGCUCG
ENSRNOT00000002327 MI0004684 mmu-miR-700 CACGCGGGAACCGAGUCCACC
ENSRNOT00000002327 MI0004696 mmu-miR-712 CUCCUUCACCCGGGCGGUACC
ENSRNOT00000002327 MI0005475 mmu-miR-882 AGGAGAGAGUUAGCGCAUUAGU
ENSRNOT00000002327 MI0000918 rno-miR-145 GUCCAGUUUUCCCAGGAAUCCCU
ENSRNOT00000002327 MI0006130 rno-miR-147 GUGUGCGGAAAUGCUUCUGCUA
ENSRNOT00000002327 MI0000922 rno-miR-153 UUGCAUAGUCACAAAAGUGAUC
ENSRNOT00000002327 MI0000936 rno-miR-193* UGGGUCUUUGCGGGCAAGAUGA
ENSRNOT00000002327 MI0000955 rno-miR-216a UAAUCUCAGCUGGCAACUGUGA
ENSRNOT00000002327 MI0000962 rno-miR-222 AGCUACAUCUGGCUACUGGGU
ENSRNOT00000002327 MI0000852 rno-miR-23a AUCACAUUGCCAGGGAUUUCC
ENSRNOT00000002327 MI0000853 rno-miR-23b AUCACAUUGCCAGGGAUUACC
ENSRNOT00000002327 MI0000854 rno-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENSRNOT00000002327 MI0000855 rno-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENSRNOT00000002327 MI0000854 rno-miR-24-1* GUGCCUACUGAGCUGAUAUCAG
ENSRNOT00000002327 MI0000855 rno-miR-24-2* GUGCCUACUGAGCUGAAACAGU
ENSRNOT00000002327 MI0000862 rno-miR-29b-2* CUGGUUUCACAUGGUGGCUUAG
ENSRNOT00000002327 MI0000866 rno-miR-30c-1* CUGGGAGAGGGUUGUUUACUCC
ENSRNOT00000002327 MI0000871 rno-miR-30c-2* CUGGGAGAAGGCUGUUUACUCU
ENSRNOT00000002327 MI0000594 rno-miR-324-5p CGCAUCCCCUAGGGCAUUGGUGU
ENSRNOT00000002327 MI0000620 rno-miR-339-5p UCCCUGUCCUCCAGGAGCUCACG
ENSRNOT00000002327 MI0000629 rno-miR-344-5p UCAGGCUCCUGGCUAGAUUCCAGG
ENSRNOT00000002327 MI0000631 rno-miR-345-3p CCCUGAACUAGGGGUCUGGAGA
ENSRNOT00000002327 MI0000877 rno-miR-34a UGGCAGUGUCUUAGCUGGUUGU
ENSRNOT00000002327 MI0000876 rno-miR-34c AGGCAGUGUAGUUAGCUGAUUGC
ENSRNOT00000002327 MI0001722 rno-miR-431 UGUCUUGCAGGCCGUCAUGCA
ENSRNOT00000002327 MI0001650 rno-miR-449a UGGCAGUGUAUUGUUAGCUGGU
ENSRNOT00000002327 MI0006168 rno-miR-488 UUGAAAGGCUGUUUCUUGGUC
ENSRNOT00000002327 MI0003480 rno-miR-501 AAUCCUUUGUCCCUGGGUGAAA
ENSRNOT00000002327 MI0006161 rno-miR-742 GAAAGCCACCAUGUUGGGUAAA
ENSRNOT00000002327 MI0006166 rno-miR-873 GCAGGAACUUGUGAGUCUCCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  2. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932