Abcf3 | GeneID:287982 | Rattus norvegicus
Gene Summary
[
] NCBI Entrez Gene
| Gene ID | 287982 | Official Symbol | Abcf3 |
|---|---|---|---|
| Locus | N/A | Gene Type | protein-coding |
| Synonyms | |||
| Full Name | ATP-binding cassette, sub-family F (GCN20), member 3 | ||
| Description | ATP-binding cassette, sub-family F (GCN20), member 3 | ||
| Chromosome | 11q23 | ||
| Also Known As | |||
| Summary | N/A | ||
Orthologs and Paralogs
[
] Homologs - NCBI's HomoloGene Group: 22784
| ID | Symbol | Protein | Species |
|---|---|---|---|
| GeneID:27406 | Abcf3 | NP_038880.1 | Mus musculus |
| GeneID:40131 | CG9330 | NP_649129.1 | Drosophila melanogaster |
| GeneID:55324 | ABCF3 | NP_060828.2 | Homo sapiens |
| GeneID:175873 | abcf-3 | NP_498339.1 | Caenorhabditis elegans |
| GeneID:287982 | Abcf3 | NP_001011896.1 | Rattus norvegicus |
| GeneID:424950 | ABCF3 | XP_422757.2 | Gallus gallus |
| GeneID:460884 | ABCF3 | XP_516910.2 | Pan troglodytes |
| GeneID:478651 | ABCF3 | XP_859024.1 | Canis lupus familiaris |
| GeneID:530975 | ABCF3 | XP_001252189.1 | Bos taurus |
| GeneID:842763 | ATGCN3 | NP_176636.1 | Arabidopsis thaliana |
| GeneID:850561 | GCN20 | NP_116664.1 | Saccharomyces cerevisiae |
| GeneID:1267735 | ENSANGG00000000043 | XP_306294.2 | Anopheles gambiae |
| GeneID:1280669 | AgaP_AGAP012005 | XP_320530.2 | Anopheles gambiae |
| GeneID:2540597 | SPBC29A3.09c | NP_595837.1 | Schizosaccharomyces pombe |
| GeneID:2705213 | NCU04051.1 | XP_323370.1 | Neurospora crassa |
| GeneID:2896717 | KLLA0A10857g | XP_451473.1 | Kluyveromyces lactis |
| GeneID:4331217 | Os02g0826500 | NP_001048587.1 | Oryza sativa |
| GeneID:4621026 | AGOS_AEL032W | NP_984829.1 | Eremothecium gossypii |
| GeneID:5050704 | MGG_11547 | XP_001411010.1 | Magnaporthe grisea |
| GeneID:100149614 | LOC100149614 | XP_001922895.1 | Danio rerio |
Gene Classification
[
] Gene Ontology
| ID | Category | GO Term |
|---|---|---|
| GO:0016887 | Function | ATPase activity |
| GO:0005524 | Function | ATP binding |
| GO:0000166 | Function | nucleotide binding |
RefSeq Isoforms
[
] RefSeq Annotation and UniProt Database
| No. | RefSeq RNA | RefSeq Protein | UniProt Equivalent |
|---|---|---|---|
| 1 | NM_001011896 UCSC Browser | NP_001011896 | |
MicroRNA and Targets
[
] MicroRNA Sequences and Transcript Targets from miRBase at Sanger
| RNA Target | miRNA # | mat miRNA | Mature miRNA Sequence |
|---|---|---|---|
| ENSRNOT00000002327 | MI0004997 | gga-miR-456 | CAGGCUGGUUAGAUGGUUGUCA |
| ENSRNOT00000002327 | MI0004998 | gga-miR-460 | CCUGCAUUGUACACACUGUGUG |
| ENSRNOT00000002327 | MI0003133 | hsa-miR-432 | UCUUGGAGUAGGUCAUUGGGUGG |
| ENSRNOT00000002327 | MI0003195 | hsa-miR-508-5p | UACUCCAGAGGGCGUCACUCAUG |
| ENSRNOT00000002327 | MI0003140 | hsa-miR-512-5p | CACUCAGCCUUGAGGGCACUUUC |
| ENSRNOT00000002327 | MI0003141 | hsa-miR-512-5p | CACUCAGCCUUGAGGGCACUUUC |
| ENSRNOT00000002327 | MI0003170 | hsa-miR-518a-5p | CUGCAAAGGGAAGCCCUUUC |
| ENSRNOT00000002327 | MI0003173 | hsa-miR-518a-5p | CUGCAAAGGGAAGCCCUUUC |
| ENSRNOT00000002327 | MI0003630 | hsa-miR-548c-3p | CAAAAAUCUCAAUUACUUUUGC |
| ENSRNOT00000002327 | MI0003668 | hsa-miR-548d-3p | CAAAAACCACAGUUUCUUUUGC |
| ENSRNOT00000002327 | MI0003671 | hsa-miR-548d-3p | CAAAAACCACAGUUUCUUUUGC |
| ENSRNOT00000002327 | MI0003559 | hsa-miR-554 | GCUAGUCCUGACUCAGCCAGU |
| ENSRNOT00000002327 | MI0003570 | hsa-miR-564 | AGGCACGGUGUCAGCAGGC |
| ENSRNOT00000002327 | MI0003578 | hsa-miR-571 | UGAGUUGGCCAUCUGAGUGAG |
| ENSRNOT00000002327 | MI0003599 | hsa-miR-589 | UGAGAACCACGUCUGCUCUGAG |
| ENSRNOT00000002327 | MI0003618 | hsa-miR-605 | UAAAUCCCAUGGUGCCUUCUCCU |
| ENSRNOT00000002327 | MI0003625 | hsa-miR-612 | GCUGGGCAGGGCUUCUGAGCUCCUU |
| ENSRNOT00000002327 | MI0003633 | hsa-miR-619 | GACCUGGACAUGUUUGUGCCCAGU |
| ENSRNOT00000002327 | MI0003637 | hsa-miR-623 | AUCCCUUGCAGGGGCUGUUGGGU |
| ENSRNOT00000002327 | MI0003639 | hsa-miR-625 | AGGGGGAAAGUUCUAUAGUCC |
| ENSRNOT00000002327 | MI0003640 | hsa-miR-626 | AGCUGUCUGAAAAUGUCUU |
| ENSRNOT00000002327 | MI0003658 | hsa-miR-643 | ACUUGUAUGCUAGCUCAGGUAG |
| ENSRNOT00000002327 | MI0003661 | hsa-miR-646 | AAGCAGCUGCCUCUGAGGC |
| ENSRNOT00000002327 | MI0003670 | hsa-miR-662 | UCCCACGUUGUGGCCCAGCAG |
| ENSRNOT00000002327 | MI0002637 | mml-miR-189 | GUGCCUACUGAGCUGAUAUCAGU |
| ENSRNOT00000002327 | MI0000244 | mmu-miR-201 | UACUCAGUAAGGCAUUGUUCUU |
| ENSRNOT00000002327 | MI0000245 | mmu-miR-202-5p | UUCCUAUGCAUAUACUUCUUU |
| ENSRNOT00000002327 | MI0005497 | mmu-miR-453 | AGGUUGCCUCAUAGUGAGCUUGCA |
| ENSRNOT00000002327 | MI0005002 | mmu-miR-490 | CAACCUGGAGGACUCCAUGCUG |
| ENSRNOT00000002327 | MI0004680 | mmu-miR-491 | AGUGGGGAACCCUUCCAUGAGG |
| ENSRNOT00000002327 | MI0005516 | mmu-miR-509-5p | UACUCCAGAAUGUGGCAAUCAU |
| ENSRNOT00000002327 | MI0003517 | mmu-miR-546 | AUGGUGGCACGGAGUC |
| ENSRNOT00000002327 | MI0004171 | mmu-miR-665 | ACCAGGAGGCUGAGGUCCCU |
| ENSRNOT00000002327 | MI0004644 | mmu-miR-682 | CUGCAGUCACAGUGAAGUCUG |
| ENSRNOT00000002327 | MI0004654 | mmu-miR-689 | CGUCCCCGCUCGGCGGGGUCC |
| ENSRNOT00000002327 | MI0004655 | mmu-miR-689 | CGUCCCCGCUCGGCGGGGUCC |
| ENSRNOT00000002327 | MI0004683 | mmu-miR-699 | AGGCAGUGCGACCUGGCUCG |
| ENSRNOT00000002327 | MI0004684 | mmu-miR-700 | CACGCGGGAACCGAGUCCACC |
| ENSRNOT00000002327 | MI0004696 | mmu-miR-712 | CUCCUUCACCCGGGCGGUACC |
| ENSRNOT00000002327 | MI0005475 | mmu-miR-882 | AGGAGAGAGUUAGCGCAUUAGU |
| ENSRNOT00000002327 | MI0000918 | rno-miR-145 | GUCCAGUUUUCCCAGGAAUCCCU |
| ENSRNOT00000002327 | MI0006130 | rno-miR-147 | GUGUGCGGAAAUGCUUCUGCUA |
| ENSRNOT00000002327 | MI0000922 | rno-miR-153 | UUGCAUAGUCACAAAAGUGAUC |
| ENSRNOT00000002327 | MI0000936 | rno-miR-193* | UGGGUCUUUGCGGGCAAGAUGA |
| ENSRNOT00000002327 | MI0000955 | rno-miR-216a | UAAUCUCAGCUGGCAACUGUGA |
| ENSRNOT00000002327 | MI0000962 | rno-miR-222 | AGCUACAUCUGGCUACUGGGU |
| ENSRNOT00000002327 | MI0000852 | rno-miR-23a | AUCACAUUGCCAGGGAUUUCC |
| ENSRNOT00000002327 | MI0000853 | rno-miR-23b | AUCACAUUGCCAGGGAUUACC |
| ENSRNOT00000002327 | MI0000854 | rno-miR-24 | UGGCUCAGUUCAGCAGGAACAG |
| ENSRNOT00000002327 | MI0000855 | rno-miR-24 | UGGCUCAGUUCAGCAGGAACAG |
| ENSRNOT00000002327 | MI0000854 | rno-miR-24-1* | GUGCCUACUGAGCUGAUAUCAG |
| ENSRNOT00000002327 | MI0000855 | rno-miR-24-2* | GUGCCUACUGAGCUGAAACAGU |
| ENSRNOT00000002327 | MI0000862 | rno-miR-29b-2* | CUGGUUUCACAUGGUGGCUUAG |
| ENSRNOT00000002327 | MI0000866 | rno-miR-30c-1* | CUGGGAGAGGGUUGUUUACUCC |
| ENSRNOT00000002327 | MI0000871 | rno-miR-30c-2* | CUGGGAGAAGGCUGUUUACUCU |
| ENSRNOT00000002327 | MI0000594 | rno-miR-324-5p | CGCAUCCCCUAGGGCAUUGGUGU |
| ENSRNOT00000002327 | MI0000620 | rno-miR-339-5p | UCCCUGUCCUCCAGGAGCUCACG |
| ENSRNOT00000002327 | MI0000629 | rno-miR-344-5p | UCAGGCUCCUGGCUAGAUUCCAGG |
| ENSRNOT00000002327 | MI0000631 | rno-miR-345-3p | CCCUGAACUAGGGGUCUGGAGA |
| ENSRNOT00000002327 | MI0000877 | rno-miR-34a | UGGCAGUGUCUUAGCUGGUUGU |
| ENSRNOT00000002327 | MI0000876 | rno-miR-34c | AGGCAGUGUAGUUAGCUGAUUGC |
| ENSRNOT00000002327 | MI0001722 | rno-miR-431 | UGUCUUGCAGGCCGUCAUGCA |
| ENSRNOT00000002327 | MI0001650 | rno-miR-449a | UGGCAGUGUAUUGUUAGCUGGU |
| ENSRNOT00000002327 | MI0006168 | rno-miR-488 | UUGAAAGGCUGUUUCUUGGUC |
| ENSRNOT00000002327 | MI0003480 | rno-miR-501 | AAUCCUUUGUCCCUGGGUGAAA |
| ENSRNOT00000002327 | MI0006161 | rno-miR-742 | GAAAGCCACCAUGUUGGGUAAA |
| ENSRNOT00000002327 | MI0006166 | rno-miR-873 | GCAGGAACUUGUGAGUCUCCU |
Selected Publications
[
] Gene-related publications indexed at PubMed
- [
] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334 - [
] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
The National Institutes of Health's Mammalian Gene Collection (MGC) project was designed to generate and sequence a publicly accessible cDNA resource containing a complete open reading frame (ORF) for every human and mouse gene. The project initially used a random strategy to select clones from a large number of cDNA libraries from diverse tissues. Candidate clones were chosen based on 5'-EST sequences, and then fully sequenced to high accuracy and analyzed by algorithms developed for this project. Currently, more than 11,000 human and 10,000 mouse genes are represented in MGC by at least one clone with a full ORF. The random selection approach is now reaching a saturation point, and a transition to protocols targeted at the missing transcripts is now required to complete the mouse and human collections. Comparison of the sequence of the MGC clones to reference genome sequences reveals that most cDNA clones are of very high sequence quality, although it is likely that some cDNAs may carry missense variants as a consequence of experimental artifact, such as PCR, cloning, or reverse transcriptase errors. Recently, a rat cDNA component was added to the project, and ongoing frog (Xenopus) and zebrafish (Danio) cDNA projects were expanded to take advantage of the high-throughput MGC pipeline.
The National Institutes of Health Mammalian Gene Collection (MGC) Program is a multiinstitutional effort to identify and sequence a cDNA clone containing a complete ORF for each human and mouse gene. ESTs were generated from libraries enriched for full-length cDNAs and analyzed to identify candidate full-ORF clones, which then were sequenced to high accuracy. The MGC has currently sequenced and verified the full ORF for a nonredundant set of >9,000 human and >6,000 mouse genes. Candidate full-ORF clones for an additional 7,800 human and 3,500 mouse genes also have been identified. All MGC sequences and clones are available without restriction through public databases and clone distribution networks (see http:mgc.nci.nih.gov).