Abca17 | GeneID:287112 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 287112 Official Symbol Abca17
Locus N/A Gene Type protein-coding
Synonyms
Full Name ATP-binding cassette, sub-family A (ABC1), member 17
Description ATP-binding cassette, sub-family A (ABC1), member 17
Chromosome 10q12
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 86807

ID Symbol Protein Species
GeneID:287112 Abca17 NP_001026807.1 Rattus norvegicus
GeneID:381072 Abca17 NP_001026792.1 Mus musculus
GeneID:529819 LOC529819 XP_608278.3 Bos taurus

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005783 Component endoplasmic reticulum
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0006638 Process neutral lipid metabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001031637  UCSC Browser NP_001026807
2 XM_001057541  UCSC Browser XP_001057541

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000060818 MI0003564 hsa-miR-558 UGAGCUGCUGUACCAAAAU
ENSRNOT00000060818 MI0003568 hsa-miR-562 AAAGUAGCUGUACCAUUUGC
ENSRNOT00000060818 MI0003682 hsa-miR-658 GGCGGAGGGAAGUAGGUCCGUUGGU
ENSRNOT00000060818 MI0005497 mmu-miR-453 AGGUUGCCUCAUAGUGAGCUUGCA
ENSRNOT00000060818 MI0003493 mmu-miR-486 UCCUGUACUGAGCUGCCCCGAG
ENSRNOT00000060818 MI0000923 rno-miR-154 UAGGUUAUCCGUGUUGCCUUCG
ENSRNOT00000060818 MI0000959 rno-miR-219-1-3p AGAGUUGCGUCUGGACGUCCCG
ENSRNOT00000060818 MI0000969 rno-miR-298 GGCAGAGGAGGGCUGUUCUUCCC
ENSRNOT00000060818 MI0000629 rno-miR-344-3p UGAUCUAGCCAAAGCCUGACCGU
ENSRNOT00000060818 MI0001423 rno-miR-421 GGCCUCAUUAAAUGUUUGUUG
ENSRNOT00000060818 MI0003527 rno-miR-541 AAGGGAUUCUGAUGUUGGUCACACU
ENSRNOT00000060818 MI0003528 rno-miR-542-3p UGUGACAGAUUGAUAACUGAAA
ENSRNOT00000060818 MI0006123 rno-miR-881 AACUGUGGCAUUUCUGAAUAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Ban N, et al. (2005) "Cloning of ABCA17, a novel rodent sperm-specific ABC (ATP-binding cassette) transporter that regulates intracellular lipid metabolism." Biochem J. 389(Pt 2):577-585. PMID:15810880