Abca5 | GeneID:286970 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 286970 Official Symbol Abca5
Locus N/A Gene Type protein-coding
Synonyms
Full Name ATP-binding cassette, sub-family A (ABC1), member 5
Description ATP-binding cassette, sub-family A (ABC1), member 5
Chromosome 10q32.1
Also Known As
Summary ATP-binding cassette (ABC) transporter [RGD]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 10263

ID Symbol Protein Species
GeneID:23461 ABCA5 NP_061142.2 Homo sapiens
GeneID:217265 Abca5 NP_671752.1 Mus musculus
GeneID:286970 Abca5 NP_775429.1 Rattus norvegicus
GeneID:417444 ABCA5 XP_415695.2 Gallus gallus
GeneID:454848 ABCA5 XP_001166542.1 Pan troglodytes
GeneID:480455 ABCA5 XP_537573.2 Canis lupus familiaris
GeneID:510497 ABCA5 XP_587636.3 Bos taurus
GeneID:1272631 AgaP_AGAP010416 XP_311531.2 Anopheles gambiae
GeneID:100151075 LOC100151075 XP_001918691.1 Danio rerio

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005794 Component Golgi apparatus
GO:0015918 Process sterol transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_173307  UCSC Browser NP_775429

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000005848 MI0000780 hsa-miR-372 AAAGUGCUGCGACAUUUGAGCGU
ENSRNOT00000005848 MI0000781 hsa-miR-373 GAAGUGCUUCGAUUUUGGGGUGU
ENSRNOT00000005848 MI0003149 hsa-miR-520a-3p AAAGUGCUUCCCUUUGGACUGU
ENSRNOT00000005848 MI0003155 hsa-miR-520b AAAGUGCUUCCUUUUAGAGGG
ENSRNOT00000005848 MI0003158 hsa-miR-520c-3p AAAGUGCUUCCUUUUAGAGGGU
ENSRNOT00000005848 MI0003164 hsa-miR-520d-3p AAAGUGCUUCUCUUUGGUGGGU
ENSRNOT00000005848 MI0003143 hsa-miR-520e AAAGUGCUUCCUUUUUGAGGG
ENSRNOT00000005848 MI0003146 hsa-miR-520f AAGUGCUUCCUUUUAGAGGGUU
ENSRNOT00000005848 MI0003603 hsa-miR-591 AGACCAUGGGUUCUCAUUGU
ENSRNOT00000005848 MI0003633 hsa-miR-619 GACCUGGACAUGUUUGUGCCCAGU
ENSRNOT00000005848 MI0003672 hsa-miR-663 AGGCGGGGCGCCGCGGGACCGC
ENSRNOT00000005848 MI0005527 hsa-miR-886-5p CGGGUCGGAGUUAGCUCAAGCGG
ENSRNOT00000005848 MI0005481 mmu-miR-105 CCAAGUGCUCAGAUGCUUGUGGU
ENSRNOT00000005848 MI0000392 mmu-miR-294 AAAGUGCUUCCCUUUUGUGUGU
ENSRNOT00000005848 MI0000393 mmu-miR-295 AAAGUGCUACUACUUUUGAGUCU
ENSRNOT00000005848 MI0000402 mmu-miR-302a UAAGUGCUUCCAUGUUUUGGUGA
ENSRNOT00000005848 MI0003716 mmu-miR-302b UAAGUGCUUCCAUGUUUUAGUAG
ENSRNOT00000005848 MI0003717 mmu-miR-302c AAGUGCUUCCAUGUUUCAGUGG
ENSRNOT00000005848 MI0003718 mmu-miR-302d UAAGUGCUUCCAUGUUUGAGUGU
ENSRNOT00000005848 MI0002400 mmu-miR-465a-5p UAUUUAGAAUGGCACUGAUGUGA
ENSRNOT00000005848 MI0005500 mmu-miR-465c-5p UAUUUAGAAUGGCGCUGAUCUG
ENSRNOT00000005848 MI0005501 mmu-miR-465c-5p UAUUUAGAAUGGCGCUGAUCUG
ENSRNOT00000005848 MI0002402 mmu-miR-467a UAAGUGCCUGCAUGUAUAUGCG
ENSRNOT00000005848 MI0004671 mmu-miR-467b GUAAGUGCCUGCAUGUAUAUG
ENSRNOT00000005848 MI0005512 mmu-miR-467c UAAGUGCGUGCAUGUAUAUGUG
ENSRNOT00000005848 MI0005513 mmu-miR-467d UAAGUGCGCGCAUGUAUAUGCG
ENSRNOT00000005848 MI0004666 mmu-miR-669b AGUUUUGUGUGCAUGUGCAUGU
ENSRNOT00000005848 MI0004704 mmu-miR-717 CUCAGACAGAGAUACCUUCUCU
ENSRNOT00000005848 MI0000907 rno-miR-134 UGUGACUGGUUGACCAGAGGGG
ENSRNOT00000005848 MI0000954 rno-miR-214 ACAGCAGGCACAGACAGGCAG
ENSRNOT00000005848 MI0000857 rno-miR-26a UUCAAGUAAUCCAGGAUAGGCU
ENSRNOT00000005848 MI0000858 rno-miR-26b UUCAAGUAAUUCAGGAUAGGU
ENSRNOT00000005848 MI0000965 rno-miR-291a-3p AAAGUGCUUCCACUUUGUGUGCC
ENSRNOT00000005848 MI0003553 rno-miR-363 AAUUGCACGGUAUCCAUCUGUA
ENSRNOT00000005848 MI0006163 rno-miR-758 UUUGUGACCUGGUCCACUAACC
ENSRNOT00000005848 MI0000880 rno-miR-93 CAAAGUGCUGUUCGUGCAGGUAG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Petry F, et al. (2006) "Subcellular localization of rat Abca5, a rat ATP-binding-cassette transporter expressed in Leydig cells, and characterization of its splice variant apparently encoding a half-transporter." Biochem J. 393(Pt 1):79-87. PMID:16162093
  2. [ + ] Kubo Y, et al. (2005) "ABCA5 resides in lysosomes, and ABCA5 knockout mice develop lysosomal disease-like symptoms." Mol Cell Biol. 25(10):4138-4149. PMID:15870284
  3. [ + ] Petry F, et al. (2003) "Cloning of human and rat ABCA5/Abca5 and detection of a human splice variant." Biochem Biophys Res Commun. 300(2):343-350. PMID:12504089