Accn3 | GeneID:286920 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 286920 Official Symbol Accn3
Locus N/A Gene Type protein-coding
Synonyms Asic3
Full Name amiloride-sensitive cation channel 3
Description amiloride-sensitive cation channel 3
Chromosome 4q11
Also Known As acid sensing ion channel 3; proton gated cation channel DRASIC
Summary subunit that forms a proton gated Na(+) channel; may play a role in prolonged pain perception [RGD]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 20999

ID Symbol Protein Species
GeneID:9311 ACCN3 NP_004760.1 Homo sapiens
GeneID:286920 Accn3 NP_775158.1 Rattus norvegicus
GeneID:482801 ACCN3 XP_539917.2 Canis lupus familiaris
GeneID:789132 ACCN3 XP_001255978.1 Bos taurus

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab10354 ASIC3 antibody (ab10354); Guinea pig polyclonal to ASIC3
2 sigma S5070 Anti-Sodium Channel ASIC3 antibody produced in rabbit ;

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005887 Component integral to plasma membrane
GO:0016020 Component membrane
GO:0005886 Component plasma membrane
GO:0015280 Function amiloride-sensitive sodium channel activity
GO:0005261 Function cation channel activity
GO:0005216 Function ion channel activity
GO:0005515 Function protein binding
GO:0031402 Function sodium ion binding
GO:0006812 Process cation transport
GO:0050907 Process detection of chemical stimulus involved in sensory perception
GO:0050968 Process detection of chemical stimulus involved in sensory perception of pain
GO:0050974 Process detection of mechanical stimulus involved in sensory perception
GO:0050966 Process detection of mechanical stimulus involved in sensory perception of pain
GO:0050961 Process detection of temperature stimulus involved in sensory perception
GO:0050965 Process detection of temperature stimulus involved in sensory perception of pain
GO:0006811 Process ion transport
GO:0001101 Process response to acid
GO:0009408 Process response to heat
GO:0009612 Process response to mechanical stimulus
GO:0006814 Process sodium ion transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_173135  UCSC Browser NP_775158

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000011300 MI0003142 hsa-miR-498 UUUCAAGCCAGGGGGCGUUUUUC
ENSRNOT00000011300 MI0003596 hsa-miR-548b-3p CAAGAACCUCAGUUGCUUUUGU
ENSRNOT00000011300 MI0003634 hsa-miR-620 AUGGAGAUAGAUAUAGAAAU
ENSRNOT00000011300 MI0003652 hsa-miR-637 ACUGGGGGCUUUCGGGCUCUGCGU
ENSRNOT00000011300 MI0003834 hsa-miR-769-3p CUGGGAUCUCCGGGGUCUUGGUU
ENSRNOT00000011300 MI0000763 mmu-miR-362-5p AAUCCUUGGAACCUAGGUGUGAAU
ENSRNOT00000011300 MI0004123 mmu-miR-675-3p CUGUAUGCCCUAACCGCUCAGU
ENSRNOT00000011300 MI0000830 rno-let-7c UGAGGUAGUAGGUUGUAUGGUU
ENSRNOT00000011300 MI0000831 rno-let-7c UGAGGUAGUAGGUUGUAUGGUU
ENSRNOT00000011300 MI0000910 rno-miR-137 UUAUUGCUUAAGAAUACGCGUAG
ENSRNOT00000011300 MI0000922 rno-miR-153 UUGCAUAGUCACAAAAGUGAUC
ENSRNOT00000011300 MI0000925 rno-miR-181a AACAUUCAACGCUGUCGGUGAGU
ENSRNOT00000011300 MI0000953 rno-miR-181a AACAUUCAACGCUGUCGGUGAGU
ENSRNOT00000011300 MI0000926 rno-miR-181b AACAUUCAUUGCUGUCGGUGGGU
ENSRNOT00000011300 MI0000927 rno-miR-181b AACAUUCAUUGCUGUCGGUGGGU
ENSRNOT00000011300 MI0000924 rno-miR-181c AACAUUCAACCUGUCGGUGAGU
ENSRNOT00000011300 MI0000860 rno-miR-27a UUCACAGUGGCUAAGUUCCGC
ENSRNOT00000011300 MI0000859 rno-miR-27b UUCACAGUGGCUAAGUUCUGC
ENSRNOT00000011300 MI0000966 rno-miR-292-5p ACUCAAACUGGGGGCUCUUUUG
ENSRNOT00000011300 MI0003551 rno-miR-369-5p AGAUCGACCGUGUUAUAUUCGC
ENSRNOT00000011300 MI0003719 rno-miR-378* CUCCUGACUCCAGGUCCUGUGU
ENSRNOT00000011300 MI0003525 rno-miR-543* AAACAUUCGCGGUGCACUUCU
ENSRNOT00000011300 MI0006164 rno-miR-760-3p CGGCUCUGGGUCUGUGGGGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Uchiyama Y, et al. (2008) "SMAD3 functions as a transcriptional repressor of acid-sensing ion channel 3 (ASIC3) in nucleus pulposus cells of the intervertebral disc." J Bone Miner Res. 23(10):1619-1628. PMID:18466073
  2. [ + ] Deval E, et al. (2008) "ASIC3, a sensor of acidic and primary inflammatory pain." EMBO J. 27(22):3047-3055. PMID:18923424
  3. [ + ] Eshcol JO, et al. (2008) "Acid-sensing ion channel 3 (ASIC3) cell surface expression is modulated by PSD-95 within lipid rafts." Am J Physiol Cell Physiol. 295(3):C732-C739. PMID:18579798
  4. [ + ] Grifoni SC, et al. (2008) "ASIC proteins regulate smooth muscle cell migration." Microvasc Res. 75(2):202-210. PMID:17936312
  5. [ + ] Uchiyama Y, et al. (2007) "Expression of acid-sensing ion channel 3 (ASIC3) in nucleus pulposus cells of the intervertebral disc is regulated by p75NTR and ERK signaling." J Bone Miner Res. 22(12):1996-2006. PMID:17696763
  6. [ + ] Tan ZY, et al. (2007) "Acid-sensing ion channels contribute to transduction of extracellular acidosis in rat carotid body glomus cells." Circ Res. 101(10):1009-1019. PMID:17872465
  7. [ + ] Cushman KA, et al. (2007) "A conformation change in the extracellular domain that accompanies desensitization of acid-sensing ion channel (ASIC) 3." J Gen Physiol. 129(4):345-350. PMID:17389250
  8. [ + ] Deval E, et al. (2006) "Regulation of sensory neuron-specific acid-sensing ion channel 3 by the adaptor protein Na+/H+ exchanger regulatory factor-1." J Biol Chem. 281(3):1796-1807. PMID:16234233
  9. [ + ] Fukuda T, et al. (2006) "ASIC3-immunoreactive neurons in the rat vagal and glossopharyngeal sensory ganglia." Brain Res. 1081(1):150-155. PMID:16510130
  10. [ + ] Wang W, et al. (2006) "Calcium-permeable acid-sensing ion channel is a molecular target of the neurotoxic metal ion lead." J Biol Chem. 281(5):2497-2505. PMID:16319075
  11. [ + ] Andrey F, et al. (2005) "Acid sensing ionic channels: modulation by redox reagents." Biochim Biophys Acta. 1745(1):1-6. PMID:16085050
  12. [ + ] Deval E, et al. (2004) "ASIC2b-dependent regulation of ASIC3, an essential acid-sensing ion channel subunit in sensory neurons via the partner protein PICK-1." J Biol Chem. 279(19):19531-19539. PMID:14976185
  13. [ + ] Diochot S, et al. (2004) "A new sea anemone peptide, APETx2, inhibits ASIC3, a major acid-sensitive channel in sensory neurons." EMBO J. 23(7):1516-1525. PMID:15044953
  14. [ + ] Hruska-Hageman AM, et al. (2004) "PSD-95 and Lin-7b interact with acid-sensing ion channel-3 and have opposite effects on H+- gated current." J Biol Chem. 279(45):46962-46968. PMID:15317815
  15. [ + ] Paukert M, et al. (2004) "Identification of the Ca2+ blocking site of acid-sensing ion channel (ASIC) 1: implications for channel gating." J Gen Physiol. 124(4):383-394. PMID:15452199
  16. [ + ] Mamet J, et al. (2003) "How nerve growth factor drives physiological and inflammatory expressions of acid-sensing ion channel 3 in sensory neurons." J Biol Chem. 278(49):48907-48913. PMID:14522957
  17. [ + ] Deval E, et al. (2003) "Effects of neuropeptide SF and related peptides on acid sensing ion channel 3 and sensory neuron excitability." Neuropharmacology. 44(5):662-671. PMID:12668052
  18. [ + ] Immke DC, et al. (2003) "Protons open acid-sensing ion channels by catalyzing relief of Ca2+ blockade." Neuron. 37(1):75-84. PMID:12526774
  19. [ + ] Alvarez de la Rosa D, et al. (2002) "Functional implications of the localization and activity of acid-sensitive channels in rat peripheral nervous system." Proc Natl Acad Sci U S A. 99(4):2326-2331. PMID:11842212
  20. [ + ] Mamet J, et al. (2002) "Proinflammatory mediators, stimulators of sensory neuron excitability via the expression of acid-sensing ion channels." J Neurosci. 22(24):10662-10670. PMID:12486159
  21. [ + ] Catarsi S, et al. (2001) "Selective modulation of heteromeric ASIC proton-gated channels by neuropeptide FF." Neuropharmacology. 41(5):592-600. PMID:11587714
  22. [ + ] Voilley N, et al. (2001) "Nonsteroid anti-inflammatory drugs inhibit both the activity and the inflammation-induced expression of acid-sensing ion channels in nociceptors." J Neurosci. 21(20):8026-8033. PMID:11588175
  23. [ + ] Immke DC, et al. (2001) "Lactate enhances the acid-sensing Na+ channel on ischemia-sensing neurons." Nat Neurosci. 4(9):869-870. PMID:11528414
  24. [ + ] Takeda T, et al. (2001) "Loss of glomerular foot processes is associated with uncoupling of podocalyxin from the actin cytoskeleton." J Clin Invest. 108(2):289-301. PMID:11457882
  25. [ + ] Sutherland SP, et al. (2001) "Acid-sensing ion channel 3 matches the acid-gated current in cardiac ischemia-sensing neurons." Proc Natl Acad Sci U S A. 98(2):711-716. PMID:11120882
  26. [ + ] Babinski K, et al. (2000) "Mammalian ASIC2a and ASIC3 subunits co-assemble into heteromeric proton-gated channels sensitive to Gd3+." J Biol Chem. 275(37):28519-28525. PMID:10842183
  27. [ + ] Coscoy S, et al. (1999) "The pre-transmembrane 1 domain of acid-sensing ion channels participates in the ion pore." J Biol Chem. 274(15):10129-10132. PMID:10187795
  28. [ + ] Chen CC, et al. (1998) "A sensory neuron-specific, proton-gated ion channel." Proc Natl Acad Sci U S A. 95(17):10240-10245. PMID:9707631
  29. [ + ] Waldmann R, et al. (1997) "Molecular cloning of a non-inactivating proton-gated Na+ channel specific for sensory neurons." J Biol Chem. 272(34):20975-20978. PMID:9261094
  30. [ + ] Lingueglia E, et al. (1997) "A modulatory subunit of acid sensing ion channels in brain and dorsal root ganglion cells." J Biol Chem. 272(47):29778-29783. PMID:9368048