Accn3 | GeneID:286920 | Rattus norvegicus
Gene Summary
[
] NCBI Entrez Gene
| Gene ID | 286920 | Official Symbol | Accn3 |
|---|---|---|---|
| Locus | N/A | Gene Type | protein-coding |
| Synonyms | Asic3 | ||
| Full Name | amiloride-sensitive cation channel 3 | ||
| Description | amiloride-sensitive cation channel 3 | ||
| Chromosome | 4q11 | ||
| Also Known As | acid sensing ion channel 3; proton gated cation channel DRASIC | ||
| Summary | subunit that forms a proton gated Na(+) channel; may play a role in prolonged pain perception [RGD] | ||
Orthologs and Paralogs
[
] Homologs - NCBI's HomoloGene Group: 20999
| ID | Symbol | Protein | Species |
|---|---|---|---|
| GeneID:9311 | ACCN3 | NP_004760.1 | Homo sapiens |
| GeneID:286920 | Accn3 | NP_775158.1 | Rattus norvegicus |
| GeneID:482801 | ACCN3 | XP_539917.2 | Canis lupus familiaris |
| GeneID:789132 | ACCN3 | XP_001255978.1 | Bos taurus |
Gene Classification
[
] Gene Ontology
| ID | Category | GO Term |
|---|---|---|
| GO:0005737 | Component | cytoplasm |
| GO:0005887 | Component | integral to plasma membrane |
| GO:0016020 | Component | membrane |
| GO:0005886 | Component | plasma membrane |
| GO:0015280 | Function | amiloride-sensitive sodium channel activity |
| GO:0005261 | Function | cation channel activity |
| GO:0005216 | Function | ion channel activity |
| GO:0005515 | Function | protein binding |
| GO:0031402 | Function | sodium ion binding |
| GO:0006812 | Process | cation transport |
| GO:0050907 | Process | detection of chemical stimulus involved in sensory perception |
| GO:0050968 | Process | detection of chemical stimulus involved in sensory perception of pain |
| GO:0050974 | Process | detection of mechanical stimulus involved in sensory perception |
| GO:0050966 | Process | detection of mechanical stimulus involved in sensory perception of pain |
| GO:0050961 | Process | detection of temperature stimulus involved in sensory perception |
| GO:0050965 | Process | detection of temperature stimulus involved in sensory perception of pain |
| GO:0006811 | Process | ion transport |
| GO:0001101 | Process | response to acid |
| GO:0009408 | Process | response to heat |
| GO:0009612 | Process | response to mechanical stimulus |
| GO:0006814 | Process | sodium ion transport |
MicroRNA and Targets
[
] MicroRNA Sequences and Transcript Targets from miRBase at Sanger
| RNA Target | miRNA # | mat miRNA | Mature miRNA Sequence |
|---|---|---|---|
| ENSRNOT00000011300 | MI0003142 | hsa-miR-498 | UUUCAAGCCAGGGGGCGUUUUUC |
| ENSRNOT00000011300 | MI0003596 | hsa-miR-548b-3p | CAAGAACCUCAGUUGCUUUUGU |
| ENSRNOT00000011300 | MI0003634 | hsa-miR-620 | AUGGAGAUAGAUAUAGAAAU |
| ENSRNOT00000011300 | MI0003652 | hsa-miR-637 | ACUGGGGGCUUUCGGGCUCUGCGU |
| ENSRNOT00000011300 | MI0003834 | hsa-miR-769-3p | CUGGGAUCUCCGGGGUCUUGGUU |
| ENSRNOT00000011300 | MI0000763 | mmu-miR-362-5p | AAUCCUUGGAACCUAGGUGUGAAU |
| ENSRNOT00000011300 | MI0004123 | mmu-miR-675-3p | CUGUAUGCCCUAACCGCUCAGU |
| ENSRNOT00000011300 | MI0000830 | rno-let-7c | UGAGGUAGUAGGUUGUAUGGUU |
| ENSRNOT00000011300 | MI0000831 | rno-let-7c | UGAGGUAGUAGGUUGUAUGGUU |
| ENSRNOT00000011300 | MI0000910 | rno-miR-137 | UUAUUGCUUAAGAAUACGCGUAG |
| ENSRNOT00000011300 | MI0000922 | rno-miR-153 | UUGCAUAGUCACAAAAGUGAUC |
| ENSRNOT00000011300 | MI0000925 | rno-miR-181a | AACAUUCAACGCUGUCGGUGAGU |
| ENSRNOT00000011300 | MI0000953 | rno-miR-181a | AACAUUCAACGCUGUCGGUGAGU |
| ENSRNOT00000011300 | MI0000926 | rno-miR-181b | AACAUUCAUUGCUGUCGGUGGGU |
| ENSRNOT00000011300 | MI0000927 | rno-miR-181b | AACAUUCAUUGCUGUCGGUGGGU |
| ENSRNOT00000011300 | MI0000924 | rno-miR-181c | AACAUUCAACCUGUCGGUGAGU |
| ENSRNOT00000011300 | MI0000860 | rno-miR-27a | UUCACAGUGGCUAAGUUCCGC |
| ENSRNOT00000011300 | MI0000859 | rno-miR-27b | UUCACAGUGGCUAAGUUCUGC |
| ENSRNOT00000011300 | MI0000966 | rno-miR-292-5p | ACUCAAACUGGGGGCUCUUUUG |
| ENSRNOT00000011300 | MI0003551 | rno-miR-369-5p | AGAUCGACCGUGUUAUAUUCGC |
| ENSRNOT00000011300 | MI0003719 | rno-miR-378* | CUCCUGACUCCAGGUCCUGUGU |
| ENSRNOT00000011300 | MI0003525 | rno-miR-543* | AAACAUUCGCGGUGCACUUCU |
| ENSRNOT00000011300 | MI0006164 | rno-miR-760-3p | CGGCUCUGGGUCUGUGGGGA |
Selected Publications
[
] Gene-related publications indexed at PubMed
- [
] Uchiyama Y, et al. (2008) "SMAD3 functions as a transcriptional repressor of acid-sensing ion channel 3 (ASIC3) in nucleus pulposus cells of the intervertebral disc." J Bone Miner Res. 23(10):1619-1628. PMID:18466073 - [
] Deval E, et al. (2008) "ASIC3, a sensor of acidic and primary inflammatory pain." EMBO J. 27(22):3047-3055. PMID:18923424 - [
] Eshcol JO, et al. (2008) "Acid-sensing ion channel 3 (ASIC3) cell surface expression is modulated by PSD-95 within lipid rafts." Am J Physiol Cell Physiol. 295(3):C732-C739. PMID:18579798 - [
] Grifoni SC, et al. (2008) "ASIC proteins regulate smooth muscle cell migration." Microvasc Res. 75(2):202-210. PMID:17936312 - [
] Uchiyama Y, et al. (2007) "Expression of acid-sensing ion channel 3 (ASIC3) in nucleus pulposus cells of the intervertebral disc is regulated by p75NTR and ERK signaling." J Bone Miner Res. 22(12):1996-2006. PMID:17696763 - [
] Tan ZY, et al. (2007) "Acid-sensing ion channels contribute to transduction of extracellular acidosis in rat carotid body glomus cells." Circ Res. 101(10):1009-1019. PMID:17872465 - [
] Cushman KA, et al. (2007) "A conformation change in the extracellular domain that accompanies desensitization of acid-sensing ion channel (ASIC) 3." J Gen Physiol. 129(4):345-350. PMID:17389250 - [
] Deval E, et al. (2006) "Regulation of sensory neuron-specific acid-sensing ion channel 3 by the adaptor protein Na+/H+ exchanger regulatory factor-1." J Biol Chem. 281(3):1796-1807. PMID:16234233 - [
] Fukuda T, et al. (2006) "ASIC3-immunoreactive neurons in the rat vagal and glossopharyngeal sensory ganglia." Brain Res. 1081(1):150-155. PMID:16510130 - [
] Wang W, et al. (2006) "Calcium-permeable acid-sensing ion channel is a molecular target of the neurotoxic metal ion lead." J Biol Chem. 281(5):2497-2505. PMID:16319075 - [
] Andrey F, et al. (2005) "Acid sensing ionic channels: modulation by redox reagents." Biochim Biophys Acta. 1745(1):1-6. PMID:16085050 - [
] Deval E, et al. (2004) "ASIC2b-dependent regulation of ASIC3, an essential acid-sensing ion channel subunit in sensory neurons via the partner protein PICK-1." J Biol Chem. 279(19):19531-19539. PMID:14976185 - [
] Diochot S, et al. (2004) "A new sea anemone peptide, APETx2, inhibits ASIC3, a major acid-sensitive channel in sensory neurons." EMBO J. 23(7):1516-1525. PMID:15044953 - [
] Hruska-Hageman AM, et al. (2004) "PSD-95 and Lin-7b interact with acid-sensing ion channel-3 and have opposite effects on H+- gated current." J Biol Chem. 279(45):46962-46968. PMID:15317815 - [
] Paukert M, et al. (2004) "Identification of the Ca2+ blocking site of acid-sensing ion channel (ASIC) 1: implications for channel gating." J Gen Physiol. 124(4):383-394. PMID:15452199 - [
] Mamet J, et al. (2003) "How nerve growth factor drives physiological and inflammatory expressions of acid-sensing ion channel 3 in sensory neurons." J Biol Chem. 278(49):48907-48913. PMID:14522957 - [
] Deval E, et al. (2003) "Effects of neuropeptide SF and related peptides on acid sensing ion channel 3 and sensory neuron excitability." Neuropharmacology. 44(5):662-671. PMID:12668052 - [
] Immke DC, et al. (2003) "Protons open acid-sensing ion channels by catalyzing relief of Ca2+ blockade." Neuron. 37(1):75-84. PMID:12526774 - [
] Alvarez de la Rosa D, et al. (2002) "Functional implications of the localization and activity of acid-sensitive channels in rat peripheral nervous system." Proc Natl Acad Sci U S A. 99(4):2326-2331. PMID:11842212 - [
] Mamet J, et al. (2002) "Proinflammatory mediators, stimulators of sensory neuron excitability via the expression of acid-sensing ion channels." J Neurosci. 22(24):10662-10670. PMID:12486159 - [
] Catarsi S, et al. (2001) "Selective modulation of heteromeric ASIC proton-gated channels by neuropeptide FF." Neuropharmacology. 41(5):592-600. PMID:11587714 - [
] Voilley N, et al. (2001) "Nonsteroid anti-inflammatory drugs inhibit both the activity and the inflammation-induced expression of acid-sensing ion channels in nociceptors." J Neurosci. 21(20):8026-8033. PMID:11588175 - [
] Immke DC, et al. (2001) "Lactate enhances the acid-sensing Na+ channel on ischemia-sensing neurons." Nat Neurosci. 4(9):869-870. PMID:11528414 - [
] Takeda T, et al. (2001) "Loss of glomerular foot processes is associated with uncoupling of podocalyxin from the actin cytoskeleton." J Clin Invest. 108(2):289-301. PMID:11457882 - [
] Sutherland SP, et al. (2001) "Acid-sensing ion channel 3 matches the acid-gated current in cardiac ischemia-sensing neurons." Proc Natl Acad Sci U S A. 98(2):711-716. PMID:11120882 - [
] Babinski K, et al. (2000) "Mammalian ASIC2a and ASIC3 subunits co-assemble into heteromeric proton-gated channels sensitive to Gd3+." J Biol Chem. 275(37):28519-28525. PMID:10842183 - [
] Coscoy S, et al. (1999) "The pre-transmembrane 1 domain of acid-sensing ion channels participates in the ion pore." J Biol Chem. 274(15):10129-10132. PMID:10187795 - [
] Chen CC, et al. (1998) "A sensory neuron-specific, proton-gated ion channel." Proc Natl Acad Sci U S A. 95(17):10240-10245. PMID:9707631 - [
] Waldmann R, et al. (1997) "Molecular cloning of a non-inactivating proton-gated Na+ channel specific for sensory neurons." J Biol Chem. 272(34):20975-20978. PMID:9261094 - [
] Lingueglia E, et al. (1997) "A modulatory subunit of acid sensing ion channels in brain and dorsal root ganglion cells." J Biol Chem. 272(47):29778-29783. PMID:9368048
The goal of this investigation was to study the regulation of acid-sensing ion channel (ASIC)3 expression by TGFbeta in the nucleus pulposus cells of the intervertebral disc. Analysis of human nucleus pulposus tissue indicated decreased ASIC3 and elevated TGFbeta expression in the degenerate state. In a parallel study, treatment of nucleus pulposus cells with TGFbeta resulted in decreased expression of ASIC3 mRNA and protein. Suppression of ASIC3 promoter activity was evident when the nucleus pulposus cells were treated with TGFbeta or co-transfected with the constitutively active ALK5 or a smad3 construct. On the other hand, co-transfection of dominant negative smad3 or smad7 restored ASIC3 promoter activity. We validated the role of smad3 in controlling ASIC3 expression using cells derived from smad3-null mice. ASIC3 promoter activity in the null cells was 2- to 3-fold higher than the wildtype cells. Moreover, expression of smad3 in null cells decreased ASIC3 promoter activity by almost 50%. Further studies using deletion constructs and trichostatin A treatment showed that the full-length smad3 was necessary, and the suppression involved recruitment of histone deacetylase to the promoter. To determine the mechanism, we evaluated the rat ASIC3 promoter sequence and noted the presence of two smad interacting CAGA box motifs. Gel-shift and supershift analysis indicated that smad3 protein was bound to this motif. Chromatin immunoprecipitation analysis confirmed that smad3 bound both the CAGA elements. Results of these studies clearly show that TGFbeta is highly expressed in the degenerate disc and through smad3 serves as a negative regulator of ASIC3 expression.
Acid-sensing ion channels (ASICs) are cationic channels activated by extracellular acidosis that are expressed in both central and peripheral nervous systems. Although peripheral ASICs seem to be natural sensors of acidic pain (e.g., in inflammation, ischaemia, lesions or tumours), a direct demonstration is still lacking. We show that approximately 60% of rat cutaneous sensory neurons express ASIC3-like currents. Native as well as recombinant ASIC3 respond synergistically to three different inflammatory signals that are slight acidifications (approximately pH 7.0), hypertonicity and arachidonic acid (AA). Moderate pH, alone or in combination with hypertonicity and AA, increases nociceptors excitability and produces pain suppressed by the toxin APETx2, a specific blocker of ASIC3. Both APETx2 and the in vivo knockdown of ASIC3 with a specific siRNA also have potent analgesic effects against primary inflammation-induced hyperalgesia in rat. Peripheral ASIC3 channels are thus essential sensors of acidic pain and integrators of molecular signals produced during inflammation where they contribute to primary hyperalgesia.
Acid-sensing ion channel 3 (ASIC3) is a H(+)-gated cation channel primarily found in sensory neurons, where it may function as a pH sensor in response to metabolic disturbances or painful conditions. We previously found that ASIC3 interacts with the postsynaptic density protein PSD-95 through its COOH terminus, which leads to a decrease in ASIC3 cell surface expression and H(+)-gated current. PSD-95 has been implicated in recruiting proteins to lipid rafts, which are membrane microdomains rich in cholesterol and sphingolipids that organize receptor/signaling complexes. We found ASIC3 and PSD-95 coimmunoprecipitated within detergent-resistant membrane fractions. When cells were exposed to methyl-beta-cyclodextrin to deplete membrane cholesterol and disrupt lipid rafts, PSD-95 localization to lipid raft fractions was abolished and no longer inhibited ASIC3 current. Likewise, mutation of two cysteine residues in PSD-95 that undergo palmitoylation (a lipid modification that targets PSD-95 to lipid rafts) prevented its inhibition of ASIC3 current and cell surface expression. In addition, we found that cell surface ASIC3 is enriched in the lipid raft fraction. These data suggest that PSD-95 and ASIC3 interact within lipid rafts and that this raft interaction is required for PSD-95 to modulate ASIC3.
The purpose of the present study was to investigate Acid Sensing Ion Channel (ASIC) protein expression and importance in cellular migration. We recently demonstrated that Epithelial Na(+)Channel (ENaC) proteins are required for vascular smooth muscle cell (VSMC) migration; however, the role of the closely related ASIC proteins has not been addressed. We used RT-PCR and immunolabeling to determine expression of ASIC1, ASIC2, ASIC3 and ASIC4 in A10 cells. We used small interference RNA to silence individual ASIC expression and determine the importance of ASIC proteins in wound healing and chemotaxis (PDGF-bb)-initiated migration. We found ASIC1, ASIC2, and ASIC3, but not ASIC4, expression in A10 cells. ASIC1, ASIC2, and ASIC3 siRNA molecules significantly suppressed expression of their respective proteins compared to non-targeting siRNA (RISC) transfected controls by 63%, 44%, and 55%, respectively. Wound healing was inhibited by 10, 20, and 26% compared to RISC controls following suppression of ASIC1, ASIC2, and ASIC3, respectively. Chemotactic migration was inhibited by 30% and 45%, respectively, following suppression of ASIC1 and ASIC3. ASIC2 suppression produced a small, but significant, increase in chemotactic migration (4%). Our data indicate that ASIC expression is required for normal migration and may suggest a novel role for ASIC proteins in cellular migration.
Although a recent study has shown that skeletal tissues express ASICs, their function is unknown. We show that intervertebral disc cells express ASIC3; moreover, expression is uniquely regulated and needed for survival in a low pH and hypoeromsotic medium. These findings suggest that ASIC3 may adapt disc cells to their hydrodynamically stressed microenvironment. INTRODUCTION: The nucleus pulposus is an avascular, hydrated tissue that permits the intervertebral disc to resist compressive loads to the spine. Because the tissue is hyperosmotic and avascular, the pH of the nucleus pulposus is low. To determine the mechanisms by which the disc cells accommodate to the low pH and hypertonicity, the expression and regulation of the acid sensing ion channel (ASIC)3 was examined. MATERIALS AND METHODS: Expression of ASICs in cells of the intervertebral disc was analyzed. To study its regulation, we cloned the 2.8-kb rat ASIC3 promoter and performed luciferase reporter assays. The effect of pharmacological inhibition of ASICs on disc cell survival was studied by measuring MTT and caspase-3 activities. RESULTS: ASIC3 was expressed in discal tissues and cultured disc cells in vitro. Because studies of neuronal cells have shown that ASIC3 expression and promoter activity is induced by nerve growth factor (NGF), we examined the effect of NGF on nucleus pulposus cells. Surprisingly, ASIC3 promoter activity did not increase after NGF treatment. The absence of induction was linked to nonexpression of tropomyosin-related kinase A (TrkA), a high-affinity NGF receptor, although a modest expression of p75NTR was seen. When treated with p75NTR antibody or transfected with dominant negative-p75NTR plasmid, there was significant suppression of ASIC3 basal promoter activity. To further explore the downstream mechanism of control of ASIC3 basal promoter activity, we blocked p75NTR and measured phospho extracellular matrix regulated kinase (pERK) levels. We found that DN-p75NTR suppressed NGF mediated transient ERK activation. Moreover, inhibition of ERK activity by dominant negative-mitogen activated protein kinase kinase (DN-MEK) resulted in a dose-dependent suppression of ASIC3 basal promoter activity, whereas overexpression of constitutively active MEK1 caused an increase in ASIC3 promoter activity. Finally, to gain insight in the functional importance of ASIC3, we suppressed ASIC activity in nucleus pulposus cells. Noteworthy, under both hyperosmotic and acidic conditions, ASIC3 served to promote cell survival and lower the activity of the pro-apoptosis protein, caspase-3. CONCLUSIONS: Results of this study indicate that NGF serves to maintain the basal expression of ASIC3 through p75NTR and ERK signaling in discal cells. We suggest that ASIC3 is needed for adaptation of the nucleus pulposus and annulus fibrosus cells to the acidic and hyperosmotic microenvironment of the intervertebral disc.
Carotid body chemoreceptors sense hypoxemia, hypercapnia, and acidosis and play an important role in cardiorespiratory regulation. The molecular mechanism of pH sensing by chemoreceptors is not clear, although it has been proposed to be mediated by a drop in intracellular pH of carotid body glomus cells, which inhibits a K+ current. Recently, pH-sensitive ion channels have been described in glomus cells that respond directly to extracellular acidosis. In this study, we investigated the possible molecular mechanisms of carotid body pH sensing by recording the responses of glomus cells isolated from rat carotid body to rapid changes in extracellular pH using the whole-cell patch-clamping technique. Extracellular acidosis evoked transient inward current in glomus cells that was inhibited by the acid-sensing ion channel (ASIC) blocker amiloride, absent in Na+-free bathing solution, and enhanced by either Ca2+-free buffer or addition of lactate. In addition, ASIC1 and ASIC3 were shown to be expressed in rat carotid body by quantitative PCR and immunohistochemistry. In the current-clamp mode, extracellular acidosis evoked both a transient and sustained depolarizations. The initial transient component of depolarization was blocked by amiloride, whereas the sustained component was eliminated by removal of K+ from the pipette solution and partially blocked by the TASK (tandem-p-domain, acid-sensitive K+ channel) blockers anandamide and quinidine. The results provide the first evidence that ASICs may contribute to chemotransduction of low pH by carotid body chemoreceptors and that extracellular acidosis directly activates carotid body chemoreceptors through both ASIC and TASK channels.
Acid-sensing ion channels (ASICs) are thought to trigger some forms of acid-induced pain and taste, and to contribute to stroke-induced neural damage. After activation by low extracellular pH, different ASICs undergo desensitization on time scales from 0.1 to 10 s. Consistent with a substantial conformation change, desensitization slows dramatically when temperature drops (Askwith, C.C., C.J. Benson, M.J. Welsh, and P.M. Snyder. 2001. PNAS. 98:6459-6463). The nature of this conformation change is unknown, but two studies showed that desensitization rate is altered by mutations on or near the first transmembrane domain (TM1) (Coric, T., P. Zhang, N. Todorovic, and C.M. Canessa. 2003. J. Biol. Chem. 278:45240-45247; Pfister, Y., I. Gautschi, A.-N. Takeda, M. van Bemmelen, S. Kellenberger, and L. Schild. 2006. J. Biol. Chem. 281:11787-11791). Here we show evidence of a specific conformation change associated with desensitization. When mutated from glutamate to cysteine, residue 79, which is some 20 amino acids extracellular to TM1, can be altered by cysteine-modifying reagents when the channel is closed, but not when it is desensitized; thus, desensitization appears to conceal the residue from the extracellular medium. D78 and E79 are a pair of adjacent acidic amino acids that are highly conserved in ASICs yet absent from epithelial Na(+) channels, their acid-insensitive relatives. Despite large effects on desensitization by mutations at positions 78 and 79-including a shift to 10-fold lower proton concentration with the E79A mutant-there are not significant effects on activation.
Acid-sensing ion channels (ASICs) are cationic channels activated by extracellular protons. The ASIC3 subunit is largely expressed in the peripheral nervous system, where it contributes to pain perception and to some aspects of mechanosensation. We report here a PDZ-dependent and protein kinase C-modulated association between ASIC3 and the Na+/H+ exchanger regulatory factor-1 (NHERF-1) adaptor protein. We show that NHERF-1 and ASIC3 are co-expressed in dorsal root ganglion neurons. NHERF-1 enhances the ASIC3 peak current in heterologous cells, including F-11 dorsal root ganglion cells, by increasing the amount of channel at the plasma membrane. Perhaps more importantly, we show that the plateau current of ASIC3 can be dramatically increased (10-30-fold) by association with NHERF-1, leading to a significant sustained current at pH 6.6. In the presence of NHERF-1, the ASIC3 subcellular localization is modified, and the channel co-localizes with ezrin, a member of the ezrin-radixin-moesin family of actin-binding proteins, providing the first direct link between ASIC3 and the cortical cytoskeleton. Given the importance of the ASIC3 sustained current in nociceptor excitability, it is likely that NHERF-1 participates in channel functions associated with nociception and mechanosensation.
ASIC3-immunoreactivity (ir) was examined in the rat vagal and glossopharyngeal sensory ganglia. In the jugular, petrosal and nodose ganglia, 24.8%, 30.8% and 20.6% of sensory neurons, respectively, were immunoreactive for ASIC3. These neurons were observed throughout the ganglia. A double immunofluorescence method demonstrated that many ASIC3-immunoreactive (ir) neurons co-expressed calcitonin gene-related peptide (CGRP)- or vanilloid receptor subtype 1 (VRL-1)-ir in the jugular (CGRP, 77.8%; VRL-1, 28.0%) and petrosal ganglia (CGRP, 61.7%; VRL-1, 21.5%). In the nodose ganglion, however, such neurons were relatively rare (CGRP, 6.3%; VRL-1, 0.4%). ASIC3-ir neurons were mostly devoid of tyrosine hydroxylase in these ganglia. However, some ASIC3-ir neurons co-expressed calbindin D-28k in the petrosal (5.5%) and nodose ganglia (3.8%). These findings may suggest that ASIC3-containing neurons have a wide variety of sensory modalities in the vagal and glossopharyngeal sensory ganglia.
Acid-sensing ion channels (ASICs) are emerging as fundamental players in the regulation of neural plasticity and in pathological conditions. Here we showed that lead (Pb2+), a well known neurotoxic metal ion, reversibly and concentration-dependently inhibited ASIC currents in the acutely dissociated spinal dorsal horn and hippocampal CA1 neurons of rats. In vitro expression of ASIC subunits in combination demonstrated that both ASIC1 and -3 subunits were sensitive to Pb2+. Mechanistically, Pb2+ reduced the pH sensitivity of ASICs independent of membrane voltage change. Moreover, Pb2+ inhibited the ASIC-mediated membrane depolarization and the elevation of intracellular Ca2+ concentration. In addition, we compared the effect of Pb2+ with that of Ca2+ or amiloride to explore the possible interactions of Pb2+ and Ca2+ in regulating ASICs, and we found that Pb2+ inhibited ASIC currents independent of the amiloride/Ca2+ blockade. Because ASIC1b and -3 subunits are mainly expressed in peripheral neurons, our data identified ASIC1a-containing Ca2+-permeable ASIC as a novel central target of Pb2+ action, which may contribute to Pb2+ neurotoxicity.
Acid-sensing ion channels (ASICs) are widely expressed in mammalian sensory neurons and supposedly play a role in nociception and acid sensing. In the course of functioning the redox status of the tissue is subjected to changes. Using whole-cell patch-clamp/concentration clamp techniques we have investigated the effect of redox reagents on the ASIC-like currents in the sensory ganglia and hippocampal neurons of rat. The reducing agent dithiothreitol (DTT), when applied in the concentrations 1-2 mM, reversibly potentiates proton-activated currents, while the oxidizing reagent 5,5'-dithio-bis-(2-nitrobenzoic acid) (DTNB) causes their inhibition. The EC50 and Hill coefficient for the activation of ASIC-like currents by protons are not affected by DTT. Redox modulation of proton-activated currents is independent on the membrane potential and on the level of pH used for the current activation. The endogenous antioxidant tripeptide glutathione (its reduced form, g-l-glutamyl-l-cysteinyl-glycine, GSH) also potentiates proton-activated currents. Our results indicate that ASIC-like currents are susceptible to regulation by redox agents.
ASIC3, an acid-sensing ion channel subunit expressed essentially in sensory neurons, has been proposed to be involved in pain. We show here for the first time that native ASIC3-like currents were increased in cultured dorsal root ganglion (DRG) neurons following protein kinase C (PKC) stimulation. This increase was induced by the phorbol ester PDBu and by pain mediators, such as serotonin, which are known to activate the PKC pathway through their binding to G protein-coupled receptors. We demonstrate that this regulation involves the silent ASIC2b subunit, an ASIC subunit also expressed in sensory neurons. Indeed, heteromultimeric ASIC3/ASIC2b channels, but not homomeric ASIC3 channels, are positively regulated by PKC. The increase of ASIC3/ASIC2b current is accompanied by a shift in its pH dependence toward more physiological pH values and may lead to an increase of sensory neuron excitability. This regulation by PKC requires PICK-1 (protein interacting with C kinase), a PDZ domain-containing protein, which interacts with the ASIC2b C terminus.
From a systematic screening of animal venoms, we isolated a new toxin (APETx2) from the sea anemone Anthopleura elegantissima, which inhibits ASIC3 homomeric channels and ASIC3-containing heteromeric channels both in heterologous expression systems and in primary cultures of rat sensory neurons. APETx2 is a 42 amino-acid peptide crosslinked by three disulfide bridges, with a structural organization similar to that of other sea anemone toxins that inhibit voltage-sensitive Na+ and K+ channels. APETx2 reversibly inhibits rat ASIC3 (IC50=63 nM), without any effect on ASIC1a, ASIC1b, and ASIC2a. APETx2 directly inhibits the ASIC3 channel by acting at its external side, and it does not modify the channel unitary conductance. APETx2 also inhibits heteromeric ASIC2b+3 current (IC50=117 nM), while it has less affinity for ASIC1b+3 (IC50=0.9 microM), ASIC1a+3 (IC50=2 microM), and no effect on the ASIC2a+3 current. The ASIC3-like current in primary cultured sensory neurons is partly and reversibly inhibited by APETx2 with an IC50 of 216 nM, probably due to the mixed inhibitions of various co-expressed ASIC3-containing channels.
The acid-sensing ion channel-3 (ASIC3) is a degenerin/epithelial sodium channel expressed in the peripheral nervous system. Previous studies indicate that it participates in the response to mechanical and painful stimuli, perhaps contributing to mechanoreceptor and/or H+ -gated nociceptor function. ASIC3 subunits contain intracellular N and C termini that may control channel localization and function. We found that a PDZ-binding motif at the ASIC3 C terminus interacts with four different proteins that contain PDZ domains: PSD-95, Lin-7b, MAGI-1b, and PIST. ASIC3 and these interacting proteins were expressed in dorsal root ganglia and spinal cord, and PSD-95 co-precipitated ASIC3 from spinal cord. When expressed in heterologous cells, PSD-95 reduced the amplitude of ASIC3 acid-evoked currents, whereas Lin-7b increased current amplitude. PSD-95 and Lin-7b altered current density by decreasing or increasing, respectively, the amount of ASIC3 on the cell surface. The finding that multiple PDZ-containing proteins bind ASIC3 and can influence its presence in the plasma membrane suggests that they may play an important role in the contribution of ASIC3 to nociception and mechanosensation.
Acid-sensing ion channels ASIC1a and ASIC1b are ligand-gated ion channels that are activated by H+ in the physiological range of pH. The apparent affinity for H+ of ASIC1a and 1b is modulated by extracellular Ca2+ through a competition between Ca2+ and H+. Here we show that, in addition to modulating the apparent H+ affinity, Ca2+ blocks ASIC1a in the open state (IC50 approximately 3.9 mM at pH 5.5), whereas ASIC1b is blocked with reduced affinity (IC50 > 10 mM at pH 4.7). Moreover, we report the identification of the site that mediates this open channel block by Ca2+. ASICs have two transmembrane domains. The second transmembrane domain M2 has been shown to form the ion pore of the related epithelial Na+ channel. Conserved topology and high homology in M2 suggests that M2 forms the ion pore also of ASICs. Combined substitution of an aspartate and a glutamate residue at the beginning of M2 completely abolished block by Ca2+ of ASIC1a, showing that these two amino acids (E425 and D432) are crucial for Ca2+ block. It has previously been suggested that relief of Ca2+ block opens ASIC3 channels. However, substitutions of E425 or D432 individually or in combination did not open channels constitutively and did not abolish gating by H+ and modulation of H+ affinity by Ca2+. These results show that channel block by Ca2+ and H+ gating are not intrinsically linked.
Nerve growth factor (NGF) is a key element of inflammatory pain. It induces hyperalgesia by up-regulating the transcription of genes encoding receptors, ion channels, and neuropeptides. Acid-sensing ion channel 3 (ASIC3), a depolarizing sodium channel gated by protons during tissue acidosis, is specifically expressed in sensory neurons. It has been associated to cardiac ischemic and inflammatory pains. We previously showed that low endogenous NGF was responsible for ASIC3 basal expression and high NGF during inflammation increased ASIC3 expression parallely to the development of neuron hyperexcitability associated with hyperalgesia. NGF is known to activate numerous signaling pathways through trkA and p75 receptors. We now show that (i). NGF controls ASIC3 basal expression through constitutive activation of a trkA/phospholipase C/protein kinase C pathway, (ii). high inflammatory-like NGF induces ASIC3 overexpression through a trkA/JNK/p38MAPK pathway and a p75-dependent mechanism as a transcriptional switch, and (iii). NGF acts through AP1 response elements in ASIC3 encoding gene promoter. These new data indicate potential targets that could be used to develop new treatments against inflammatory pain.
Acid sensing ion channel 3 (ASIC3) is a cation channel gated by extracellular protons. It is highly expressed in sensory neurons, including small nociceptive neurons and has been proposed to participate in pain perception associated with tissue acidosis and in mechanoperception. Neuropeptide FF (NPFF) and FMRFamide have been shown to potentiate proton-gated currents from cultured sensory neurons and acid sensing ion channel (ASIC) cDNA transfected cells. In this study, we report that another mammalian peptide neuropeptide SF (NPSF), derived from the same precursor, also considerably increases the amplitude of the sustained current of heterologously expressed ASIC3 (12-fold vs. 19- and nine-fold for FMRFamide and NPFF, respectively) with an EC(50) of approximately 50 microM. Similar effects were also observed on endogenous ASIC3-like sustained current recorded from DRG neurons although of smaller amplitudes (two-, three- and seven-fold increase for NPSF, NPFF and FMRFamide, respectively), and essentially related to a slowing down of the inactivation rate. Importantly, this modulation induced changes in neuronal excitability in response to an electrical stimulus applied during extracellular acidification. ASIC3-mediated sustained depolarisation, and its regulation by neuropeptides, could thus be important in regulating polymodal neuron excitability particularly under inflammatory conditions where the expression levels of both NPFF precursor and ASIC3 are increased.
Acid-sensing ion channels (ASICs) open when extracellular pH drops and they are enhanced by lactate, making them specialized for detecting lactic acidosis. Highly expressed on cardiac nociceptors and some other sensory neurons, ASICs may help trigger pain caused by tissue ischemia. We report that H(+) opens ASIC3 by speeding release of Ca(2+) from a high-affinity binding site (K(Ca) = 150 nM) on the extracellular side of the pore. The bound Ca(2+) blocks permeation and the channel conducts when multiple H(+) ions relieve this block. Activation through Ca(2+) explains sensitivity to lactate, which decreases extracellular [Ca(2+)], and it may prove relevant in CNS pathologies (stroke, seizure) that simultaneously drop pH and Ca(2+).
Acid-sensitive ion channels (ASIC) are proton-gated ion channels expressed in neurons of the mammalian central and peripheral nervous systems. The functional role of these channels is still uncertain, but they have been proposed to constitute mechanoreceptors and/or nociceptors. We have raised specific antibodies for ASIC1, ASIC2, ASIC3, and ASIC4 to examine the distribution of these proteins in neurons from dorsal root ganglia (DRG) and to determine their subcellular localization. Western blot analysis demonstrates that all four ASIC proteins are expressed in DRG and sciatic nerve. Immunohistochemical experiments and functional measurements of unitary currents from the ASICs with the patch-clamp technique indicate that ASIC1 localizes to the plasma membrane of small-, medium-, and large-diameter cells, whereas ASIC2 and ASIC3 are preferentially in medium to large cells. Neurons coexpressing ASIC2 and ASIC3 form predominantly heteromeric ASIC2-3 channels. Two spliced forms, ASIC2a and ASIC2b, colocalize in the same population of DRG neurons. Within cells, the ASICs are present mainly on the plasma membrane of the soma and cellular processes. Functional studies indicate that the pH sensitivity for inactivation of ASIC1 is much higher than the one for activation; hence, increases in proton concentration will inactivate the channel. These functional properties and localization in DRG have profound implications for the putative functional roles of ASICs in the nervous system.
Tissue acidosis is an important feature of inflammation. It is a direct cause of pain and hyperalgesia. Protons activate sensory neurons mainly through acid-sensing ion channels (ASICs) and the subsequent membrane depolarization that leads to action potential generation. We had previously shown that ASIC transcript levels were increased in inflammatory conditions in vivo. We have now found that this increase is caused by the proinflammatory mediators NGF, serotonin, interleukin-1, and bradykinin. A mixture of these mediators increases ASIC-like current amplitude on sensory neurons as well as the number of ASIC-expressing neurons and leads to a higher sensory neuron excitability. An analysis of the promoter region of the ASIC3 encoding gene, an ASIC specifically expressed in sensory neurons and associated with chest pain that accompanies cardiac ischemia, reveals that gene transcription is controlled by NGF and serotonin.
Proton-gated channels of the acid-sensing ion channel (ASIC) family are candidates for mediating the fast ionotropic transduction of extracellular acidification in neurons. ASIC subunits can assemble in homomeric and heteromeric channels with specific biophysical and pharmacological properties. Using heterologous expression of ASIC subunits in Xenopus oocytes, we show here that the biphasic response of heteromeric rat and human ASIC2A+3 subtypes to low pH is selectively modulated by the neuropeptide FF (NPFF) and by the related peptide FMRFamide. We recorded both a dramatic potentiation (up to 275%) of the amplitude of acid-gated human ASIC2A+3 maximal currents and a change of desensitization kinetics in the presence of NPFF (EC(50)=2 microM) leading to a slowly inactivating phenotype. These modulatory effects were not observed with the corresponding homomeric human ASIC2A or ASIC3 receptor subtypes. Moreover, the sensitivity of ASIC2A+3 receptors to extracellular protons was increased in the presence of NPFF (DeltapH(50)=+0.5). Our data therefore suggest that the direct sensitization of heteromeric proton-gated channels by endogenous neuropeptides might play a role in the neuronal response to noxious acidosis in sensory and central pathways.
Nonsteroid anti-inflammatory drugs (NSAIDs) are major drugs against inflammation and pain. They are well known inhibitors of cyclooxygenases (COXs). However, many studies indicate that they may also act on other targets. Acidosis is observed in inflammatory conditions such as chronic joint inflammation, in tumors and after ischemia, and greatly contributes to pain and hyperalgesia. Administration of NSAIDs reduces low-pH-induced pain. The acid sensitivity of nociceptors is associated with activation of H(+)-gated ion channels. Several of these, cloned recently, correspond to the acid-sensing ion channels (ASICs) and others to the vanilloid receptor family. This paper shows (1) that ASIC mRNAs are present in many small sensory neurons along with substance P and isolectin B4 and that, in case of inflammation, ASIC1a appears in some larger Abeta fibers, (2) that NSAIDs prevent the large increase of ASIC expression in sensory neurons induced by inflammation, and (3) that NSAIDs such as aspirin, diclofenac, and flurbiprofen directly inhibit ASIC currents on sensory neurons and when cloned ASICs are heterologously expressed. These results suggest that the combined capacity to block COXs and inhibit both inflammation-induced expression and activity of ASICs present in nociceptors is an important factor in the action of NSAIDs against pain.
Lactic acid produced by anaerobic metabolism during cardiac ischemia is among several compounds suggested to trigger anginal chest pain; however, the pH reached when a coronary artery is occluded (pH 7.0 to 6.7) can also occur during systemic acidosis, which causes no chest pain. Here we show that lactate, acting through extracellular divalent ions, dramatically increases activity of an acid-sensing ion channel (ASIC) that is highly expressed on sensory neurons that innervate the heart. The effect should confer upon neurons that express ASICs an extra sensitivity to the lactic acidosis of local ischemia compared to acidity caused by systemic pathology.
Podocalyxin (PC), the major sialoprotein of glomerular epithelial cells (GECs), helps maintain the characteristic architecture of the foot processes and the patency of the filtration slits. PC associates with actin via ezrin, a member of the ERM family of cytoskeletal linker proteins. Here we show that PC is linked to ezrin and the actin cytoskeleton via Na(+)/H(+)-exchanger regulatory factor 2 (NHERF2), a scaffold protein containing two PDZ (PSD-95/Dlg/ZO-1) domains and an ERM-binding region. The cytoplasmic tail of PC contains a C-terminal PDZ-binding motif (DTHL) that binds to the second PDZ domain of NHERF2 in yeast two-hybrid and in vitro pull-down assays. By immunocytochemistry NHERF2 colocalizes with PC and ezrin along the apical domain of the GEC plasma membrane. NHERF2 and ezrin form a multimeric complex with PC, as they coimmunoprecipitate with PC. The PC/NHERF2/ezrin complex interacts with the actin cytoskeleton, and this interaction is disrupted in GECs from puromycin aminonucleoside-, protamine sulfate-, or sialidase-treated rats, which show a dramatic loss of foot processes, comparable to that seen in the nephrotic syndrome. Thus NHERF2 appears to function as a scaffold protein linking PC to ezrin and the actin cytoskeleton. PC/NHERF2/ezrin/actin interactions are disrupted in pathologic conditions associated with changes in GEC foot processes, indicating their importance for maintaining the unique organization of this epithelium.
Cardiac afferents are sensory neurons that mediate angina, pain that occurs when the heart receives insufficient blood supply for its metabolic demand (ischemia). These neurons display enormous acid-evoked depolarizing currents, and they fire action potentials in response to extracellular acidification that accompanies myocardial ischemia. Here we show that acid-sensing ion channel 3 (ASIC3), but no other known acid-sensing ion channel, reproduces the functional features of the channel that underlies the large acid-evoked current in cardiac afferents. ASIC3 and the native channel are both especially sensitive to pH, interact similarly with Ca(2+), and gate rapidly between closed, open, and desensitized states. Particularly important is the ability of ASIC3 and the native channel to open at pH 7, a value reached in the first few minutes of a heart attack. The steep activation curve suggests that the channel opens when four protons bind. We propose that ASIC3, a member of the degenerin channel (of Caenorhabditis elegans)/epithelial sodium channel family of ion channels, is the sensor of myocardial acidity that triggers cardiac pain, and that it might be a useful pharmaceutical target for treating angina.
Proton receptors of the acid-sensing ion channel (ASIC) family are expressed in sensory neurons and thus could play a critical role in the detection of noxious acidosis. To investigate the subunit composition of native ASICs in peripheral and central neurons, we co-injected human as well as rodent ASIC2a and ASIC3 subunits in Xenopus oocytes. The amplitudes of acid-induced biphasic responses mediated by co-expressed ASIC2a and ASIC3 subunits were much larger (as much as 20-fold) than the currents mediated by the respective homomers, clearly indicating functional association. The reversal potential of the ASIC2a+3 current (>/=+20 mV) reflected a cationic current mainly selective for sodium. The sensitivity to pH or amiloride of single versus co-expressed ASIC subunits was not significantly different; however, gadolinium ions inhibited ASIC3 and ASIC2a+3 responses with much higher potency (IC(50) approximately 40 microm) than the ASIC2a response (IC(50) >/=1 mm). Biochemical interaction between ASIC2a and ASIC3 subunits was demonstrated by co-purification from transfected human embryonic kidney (HEK293) cells and Xenopus oocytes. Our in situ hybridization data showed that rat ASIC2a and ASIC3 transcripts are co-localized centrally, whereas reverse transcription-polymerase chain reaction data led us to detect co-expression of human ASIC2a and ASIC3 subunits in trigeminal sensory ganglia, brain, and testis where they might co-assemble into a novel subtype of proton-gated channels sensitive to gadolinium.
The acid-sensing ion channel (ASIC) subunits ASIC1, ASIC2, and ASIC3 are members of the amiloride-sensitive Na+ channel/degenerin family of ion channels. They form proton-gated channels that are expressed in the central nervous system and in sensory neurons, where they are thought to play an important role in pain accompanying tissue acidosis. A splice variant of ASIC2, ASIC2b, is not active on its own but modifies the properties of ASIC3. In particular, whereas most members of the amiloride-sensitive Na+ channel/degenerin family are highly selective for Na+ over K+, ASIC3/ASIC2b heteromultimers show a nonselective component. Chimeras of the two splice variants allowed identification of a 9-amino acid region preceding the first transmembrane (TM) domain (pre-TM1) of ASIC2 that is involved in ion permeation and is critical for Na+ selectivity. Three amino acids in this region (Ile-19, Phe-20, and Thr-25) appear to be particularly important, because channels mutated at these residues discriminate poorly between Na+ and K+. In addition, the pH dependences of the activity of the F20S and T25K mutants are changed as compared with that of wild-type ASIC2. A corresponding ASIC3 mutant (T26K) also has modified Na+ selectivity. Our results suggest that the pre-TM1 region of ASICs participates in the ion pore.
Proton-gated channels expressed by sensory neurons are of particular interest because low pH causes pain. Two proton-gated channels, acid-sensing ionic channel (ASIC) and dorsal root ASIC (DRASIC), that are members of the amiloride-sensitive ENaC/Degenerin family are known to be expressed by sensory neurons. Here, we describe the cloning and characterization of an ASIC splice variant, ASIC-beta, which contains a unique N-terminal 172 aa, as well as unique 5' and 3' untranslated sequences. ASIC-beta, unlike ASIC and DRASIC, is found only in a subset of small and large diameter sensory neurons and is absent from sympathetic neurons or the central nervous system. The patterns of expression of ASIC and ASIC-beta transcripts in rat dorsal root ganglion neurons are distinct. When expressed in COS-7 cells, ASIC-beta forms a functional channel with electrophysiological properties distinct from ASIC and DRASIC. The pH dependency and sensitivity to amiloride of ASIC-beta is similar to that described for ASIC, but unlike ASIC, the channel is not permeable to calcium, nor are ASIC-beta-mediated currents inhibited by extracellular calcium. The unique distribution of ASIC-beta suggests that it may play a specialized role in sensory neuron function.
We have cloned and expressed a novel proton-gated Na+ channel subunit that is specific for sensory neurons. In COS cells, it forms a Na+ channel that responds to a drop of the extracellular pH with both a rapidly inactivating and a sustained Na+ current. This biphasic kinetic closely resembles that of the H+-gated current described in sensory neurons of dorsal root ganglia (1). Both the abundance of this novel H+-gated Na+ channel subunit in sensory neurons and the kinetics of the channel suggest that it is part of the channel complex responsible for the sustained H+-activated cation current in sensory neurons that is thought to be important for the prolonged perception of pain that accompanies tissue acidosis (1, 2).
MDEG1 is a cation channel expressed in brain that belongs to the degenerin/epithelial Na+ channel superfamily. It is activated by the same mutations which cause neurodegeneration in Caenorhabditis elegans if present in the degenerins DEG-1, MEC-4, and MEC-10. MDEG1 shares 67% sequence identity with the recently cloned proton-gated cation channel ASIC (acid sensing ion channel), a new member of the family which is present in brain and in sensory neurons. We have now identified MDEG1 as a proton-gated channel with properties different from those of ASIC. MDEG1 requires more acidic pH values for activation and has slower inactivation kinetics. In addition, we have cloned from mouse and rat brain a splice variant form of the MDEG1 channel which differs in the first 236 amino acids, including the first transmembrane region. This new membrane protein, which has been called MDEG2, is expressed in both brain and sensory neurons. MDEG2 is activated neither by mutations that bring neurodegeneration once introduced in C. elegans degenerins nor by low pH. However, it can associate both with MDEG1 and another recently cloned H+-activated channel DRASIC to form heteropolymers which display different kinetics, pH dependences, and ion selectivities. Of particular interest is the subunit combination specific for sensory neurons, MDEG2/DRASIC. In response to a drop in pH, it gives rise to a biphasic current with a sustained current which discriminates poorly between Na+ and K+, like the native H+-gated current recorded in dorsal root ganglion cells. This sustained current is thought to be required for the tonic sensation of pain caused by acids.