ABCC1 | GeneID:281588 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 281588 Official Symbol ABCC1
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family C (CFTR/MRP), member 1
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 55459

ID Symbol Protein Species
GeneID:4363 ABCC1 NP_004987.2 Homo sapiens
GeneID:17250 Abcc1 NP_032602.1 Mus musculus
GeneID:24565 Abcc1 NP_071617.2 Rattus norvegicus
GeneID:34686 MRP NP_995695.1 Drosophila melanogaster
GeneID:180408 mrp-2 NP_508121.1 Caenorhabditis elegans
GeneID:180409 mrp-1 NP_001033553.1 Caenorhabditis elegans
GeneID:281588 ABCC1 NP_776648.1 Bos taurus
GeneID:395416 ABCC1 NP_001012540.1 Gallus gallus
GeneID:403453 ABCC1 NP_001002971.1 Canis lupus familiaris
GeneID:453952 ABCC1 XP_001145351.1 Pan troglodytes
GeneID:839277 ATMRP5 NP_171908.1 Arabidopsis thaliana
GeneID:851713 YCF1 NP_010419.1 Saccharomyces cerevisiae
GeneID:1279254 AgaP_AGAP009835 XP_553715.1 Anopheles gambiae
GeneID:2540937 abc3 NP_595055.1 Schizosaccharomyces pombe
GeneID:2543193 abc2 NP_593943.1 Schizosaccharomyces pombe
GeneID:2679616 MGG_01674 XP_363748.2 Magnaporthe grisea
GeneID:2713263 NCU09012.1 XP_331404.1 Neurospora crassa
GeneID:2895493 KLLA0F20075g XP_455982.1 Kluyveromyces lactis
GeneID:4331585 Os03g0142800 NP_001048934.1 Oryza sativa
GeneID:4623012 AGOS_AGR047W NP_986712.1 Eremothecium gossypii
GeneID:100002010 LOC100002010 XP_001341895.2 Danio rerio

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0005215 Function transporter activity
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_174223 NP_776648

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000028094 MI0005057 bta-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSBTAT00000028094 MI0005451 bta-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSBTAT00000028094 MI0005452 bta-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSBTAT00000028094 MI0005453 bta-let-7b UGAGGUAGUAGGUUGUGUGGUU
ENSBTAT00000028094 MI0005454 bta-let-7c UGAGGUAGUAGGUUGUAUGGUU
ENSBTAT00000028094 MI0005026 bta-let-7d AGAGGUAGUAGGUUGCAUAGUU
ENSBTAT00000028094 MI0005455 bta-let-7e UGAGGUAGGAGGUUGUAUAGU
ENSBTAT00000028094 MI0004734 bta-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENSBTAT00000028094 MI0005062 bta-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENSBTAT00000028094 MI0005051 bta-let-7g UGAGGUAGUAGUUUGUACAGUU
ENSBTAT00000028094 MI0005031 bta-miR-17-3p ACUGCAGUGAAGGCACUUGU
ENSBTAT00000028094 MI0005036 bta-miR-199b CCCAGUGUUUAGACUAUCUGUUC
ENSBTAT00000028094 MI0005019 bta-miR-345 GCUGACUCCUAGUCCAGUGCU
ENSBTAT00000028094 MI0005025 bta-miR-98 UGAGGUAGUAAGUUGUAUUGUU
ENSBTAT00000028094 MI0004997 gga-miR-456 CAGGCUGGUUAGAUGGUUGUCA
ENSBTAT00000028094 MI0000473 hsa-miR-129-3p AAGCCCUUACCCCAAAAAGCAU
ENSBTAT00000028094 MI0000481 hsa-miR-184 UGGACGGAGAACUGAUAAGGGU
ENSBTAT00000028094 MI0000807 hsa-miR-323-5p AGGUGGUCCGUGGCGCGUUCGC
ENSBTAT00000028094 MI0003760 hsa-miR-671-5p AGGAAGCCCUGGAGGGGCUGGAG
ENSBTAT00000028094 MI0000630 mmu-miR-344 UGAUCUAGCCAAAGCCUGACUGU
ENSBTAT00000028094 MI0005495 mmu-miR-344 UGAUCUAGCCAAAGCCUGACUGU
ENSBTAT00000028094 MI0002401 mmu-miR-466a-5p UAUGUGUGUGUACAUGUACAUA
ENSBTAT00000028094 MI0005502 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENSBTAT00000028094 MI0005503 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENSBTAT00000028094 MI0005504 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENSBTAT00000028094 MI0005505 mmu-miR-466c-5p GAUGUGUGUGUGCAUGUACAUA
ENSBTAT00000028094 MI0005546 mmu-miR-466d-5p UGUGUGUGCGUACAUGUACAUG
ENSBTAT00000028094 MI0005506 mmu-miR-466e-5p GAUGUGUGUGUACAUGUACAUA
ENSBTAT00000028094 MI0005507 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENSBTAT00000028094 MI0005508 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENSBTAT00000028094 MI0005509 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENSBTAT00000028094 MI0005511 mmu-miR-466h UGUGUGCAUGUGCUUGUGUGUA
ENSBTAT00000028094 MI0002403 mmu-miR-468 UAUGACUGAUGUGCGUGUGUCUG
ENSBTAT00000028094 MI0003517 mmu-miR-546 AUGGUGGCACGGAGUC
ENSBTAT00000028094 MI0004677 mmu-miR-696 GCGUGUGCUUGCUGUGGG
ENSBTAT00000028094 MI0004699 mmu-miR-714 CGACGAGGGCCGGUCGGUCGC
ENSBTAT00000028094 MI0004516 mmu-miR-763 CCAGCUGGGAAGAACCAGUGGC
ENSBTAT00000028094 MI0005472 mmu-miR-879 AGAGGCUUAUAGCUCUAAGCC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Taguchi Y, et al. (2002) "Functional analysis of MRP1 cloned from bovine." FEBS Lett. 521(1-3):211-213. PMID:12067707