ABCA4 | GeneID:281584 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 281584 Official Symbol ABCA4
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family A (ABC1), member 4
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 298

ID Symbol Protein Species
GeneID:24 ABCA4 NP_000341.2 Homo sapiens
GeneID:11304 Abca4 NP_031404.1 Mus musculus
GeneID:171782 abt-2 NP_490949.3 Caenorhabditis elegans
GeneID:281584 ABCA4 NP_776646.1 Bos taurus
GeneID:310836 Abca4 XP_241525.3 Rattus norvegicus
GeneID:424490 ABCA4 XP_422330.2 Gallus gallus
GeneID:444852 ABCA4 NP_001003360.2 Canis lupus familiaris
GeneID:555506 LOC555506 XP_683123.3 Danio rerio
GeneID:745972 ABCA4 XP_001152577.1 Pan troglodytes

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005887 Component integral to plasma membrane
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0004012 Function phospholipid-translocating ATPase activity
GO:0005548 Function phospholipid transporter activity
GO:0006649 Process phospholipid transfer to membrane
GO:0045494 Process photoreceptor cell maintenance
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_174221 NP_776646

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000023982 MI0005008 bta-miR-127 UCGGAUCCGUCUGAGCUUGGCU
ENSBTAT00000023982 MI0004763 bta-miR-34b AGGCAGUGUAAUUAGCUGAUUG
ENSBTAT00000023982 MI0005068 bta-miR-34c AGGCAGUGUAGUUAGCUGAUUG
ENSBTAT00000023982 MI0005045 bta-miR-361 UUAUCAGAAUCUCCAGGGGUAC
ENSBTAT00000023982 MI0005046 bta-miR-423 AAGCUCGGUCUGAGGCCCCUCAGU
ENSBTAT00000023982 MI0000480 hsa-miR-154 UAGGUUAUCCGUGUUGCCUUCG
ENSBTAT00000023982 MI0005570 hsa-miR-208b AUAAGACGAACAAAAGGUUUGU
ENSBTAT00000023982 MI0000287 hsa-miR-211 UUCCCUUUGUCAUCCUUCGCCU
ENSBTAT00000023982 MI0002470 hsa-miR-486-5p UCCUGUACUGAGCUGCCCCGAG
ENSBTAT00000023982 MI0003171 hsa-miR-518d-3p CAAAGCGCUUCCCUUUGGAGC
ENSBTAT00000023982 MI0003515 hsa-miR-544 AUUCUGCAUUUUUAGCAAGUUC
ENSBTAT00000023982 MI0003564 hsa-miR-558 UGAGCUGCUGUACCAAAAU
ENSBTAT00000023982 MI0003681 hsa-miR-657 GGCAGGUUCUCACCCUCUCUAGG
ENSBTAT00000023982 MI0005537 hsa-miR-888 UACUCAAAAAGCUGUCAGUCA
ENSBTAT00000023982 MI0005533 hsa-miR-890 UACUUGGAAAGGCAUCAGUUG
ENSBTAT00000023982 MI0005528 hsa-miR-892a CACUGUGUCCUUUCUGCGUAG
ENSBTAT00000023982 MI0004553 mmu-miR-666-3p GGCUGCAGCGUGAUCGCCUGCU
ENSBTAT00000023982 MI0004688 mmu-miR-704 AGACAUGUGCUCUGCUCCUAG
ENSBTAT00000023982 MI0004698 mmu-miR-713 UGCACUGAAGGCACACAGC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

NM_174221   U78767   U90126  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

AAB81233   AAC48716   NP_776646   O02698   O02716  

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Beharry S, et al. (2004) "N-retinylidene-phosphatidylethanolamine is the preferred retinoid substrate for the photoreceptor-specific ABC transporter ABCA4 (ABCR)." J Biol Chem. 279(52):53972-53979. PMID:15471866
  2. [ + ] Illing M, et al. (1997) "The 220-kDa rim protein of retinal rod outer segments is a member of the ABC transporter superfamily." J Biol Chem. 272(15):10303-10310. PMID:9092582
  3. [ + ] Thomson JL, et al. (1997) "Photoreceptor rim protein: partial sequences of cDNA show a high degree of similarity to ABC transporters." Curr Eye Res. 16(7):741-745. PMID:9222095