ABO | GeneID:28 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 28 Official Symbol ABO
Locus N/A Gene Type protein-coding
Synonyms A3GALNT; A3GALT1; GTB; NAGAT
Full Name ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase; transferase B, alpha 1-3-galactosyltransferase)
Description ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase; transferase B, alpha 1-3-galactosyltransferase)
Chromosome 9q34.1-q34.2
Also Known As ABO blood group (alpha 1-3-N-acetylgalactosaminyltransferase, alpha 1-3-galactosyltransferase); ABO glycosyltransferase; B(A) alpha-1,3-galactosyltransferase; histo-blood group A2 transferase
Summary This gene encodes proteins related to the first discovered blood group system, ABO. Which allele is present in an individual determines the blood group. The 'O' blood group is caused by a deletion of guanine-258 near the N-terminus of the protein which results in a frameshift and translation of an almost entirely different protein. Individuals with the A, B, and AB alleles express glycosyltransferase activities that convert the H antigen into the A or B antigen. Other minor alleles have been found for this gene. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 69306

ID Symbol Protein Species
GeneID:28 ABO NP_065202.2 Homo sapiens
GeneID:65270 Abo NP_075582.2 Rattus norvegicus
GeneID:80908 Abo NP_109643.2 Mus musculus
GeneID:296504 Abo_predicted XP_215986.3 Rattus norvegicus
GeneID:450164 ABO XP_520338.2 Pan troglodytes
GeneID:491265 ABO XP_548386.2 Canis lupus familiaris
GeneID:515340 ABO XP_001256289.1 Bos taurus

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab3353 Blood Group A Antigen antibody [T36] (ab3353); Mouse monoclonal [T36] to Blood Group A Antigen
2 abcam ab33404 Blood Group H2 antigen antibody [BRIC231] (ab33404); Mouse monoclonal [BRIC231] to Blood Group H2 antigen
3 abcam ab31754 Blood Group H1 + Blood Group H2 antibody [0.BG.5] (ab31754); Mouse monoclonal [0.BG.5] to Blood Group H1 + Blood Group H2
4 abcam ab2525 Blood Group A1B Antigen antibody [HE-24] (ab2525); Mouse monoclonal [HE-24] to Blood Group A1B Antigen
5 abcam ab20131 Blood Group A Antigen antibody [9A] (ab20131); Mouse monoclonal [9A] to Blood Group A Antigen
6 abcam ab2521 Blood Group A Antigen antibody [HE-193] (ab2521); Mouse monoclonal [HE-193] to Blood Group A Antigen
7 abcam ab2522 Blood Group A Antigen antibody [HE-195] (ab2522); Mouse monoclonal [HE-195] to Blood Group A Antigen
8 abcam ab2523 Blood Group A, B and H Antigens antibody [HE-10] (ab2523); Mouse monoclonal [HE-10] to Blood Group A, B and H Antigens
9 abcam ab24223 Blood Group AB antigen antibody [Z5H-2/Z2A] (ab24223); Mouse monoclonal [Z5H-2/Z2A] to Blood Group AB antigen
10 abcam ab3352 Blood Group Antigen Precursor antibody [K21] (ab3352); Mouse monoclonal [K21] to Blood Group Antigen Precursor
11 abcam ab3354 Blood Group B Antigen antibody [CLCP-19B] (ab3354); Mouse monoclonal [CLCP-19B] to Blood Group B Antigen
12 abcam ab2524 Blood Group B Antigen antibody [HEB-29] (ab2524); Mouse monoclonal [HEB-29] to Blood Group B Antigen
13 abcam ab24224 Blood Group B Antigen antibody [Z5H-2] (ab24224); Mouse monoclonal [Z5H-2] to Blood Group B Antigen
14 abcam ab3355 Blood Group H1 (O) antigen antibody [17-206] (ab3355); Mouse monoclonal [17-206] to Blood Group H1 (O) antigen
15 abcam ab24222 Blood Group H ab antigen antibody [87-N] (ab24222); Mouse monoclonal [87-N] to Blood Group H ab antigen
16 abcam ab36703 Blood Group H5 + Blood Group H6 antibody [HE-182] (ab36703); Mouse monoclonal [HE-182] to Blood Group H5 + Blood Group H6
17 scbt ABO ABO Antibody / ABO Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABO Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABO Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005576 Component extracellular region
GO:0005794 Component Golgi apparatus
GO:0032580 Component Golgi cisterna membrane
GO:0030173 Component integral to Golgi membrane
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0004381 Function fucosylgalactoside 3-alpha-galactosyltransferase activity
GO:0004380 Function glycoprotein-fucosylgalactoside alpha-N-acetylgalactosaminyltransferase activity
GO:0030145 Function manganese ion binding
GO:0046872 Function metal ion binding
GO:0016758 Function transferase activity, transferring hexosyl groups
GO:0005975 Process carbohydrate metabolic process
GO:0006486 Process protein amino acid glycosylation

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_020469  UCSC Browser NP_065202 P16442   Q53I57  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000319878 MI0000811 hsa-miR-148b* AAGUUCUGUUAUACACUCAGGC
ENST00000319878 MI0000478 hsa-miR-149* AGGGAGGGACGGGGGCUGUGC
ENST00000319878 MI0000481 hsa-miR-184 UGGACGGAGAACUGAUAAGGGU
ENST00000319878 MI0000274 hsa-miR-187 UCGUGUCUUGUGUUGCAGCCGG
ENST00000319878 MI0000290 hsa-miR-214 ACAGCAGGCACAGACAGGCAGU
ENST00000319878 MI0000085 hsa-miR-27a* AGGGCUUAGCUGCUUGUGAGCA
ENST00000319878 MI0000440 hsa-miR-27b* AGAGCUUAGCUGAUUGGUGAAC
ENST00000319878 MI0000744 hsa-miR-299-5p UGGUUUACCGUCCCACAUACAU
ENST00000319878 MI0000812 hsa-miR-331-3p GCCCCUGGGCCUAUCCUAGAA
ENST00000319878 MI0000783 hsa-miR-375 UUUGUUCGUUCGGCUCGCGUGA
ENST00000319878 MI0003127 hsa-miR-511 GUGUCUUUUGCUCUGCAGUCA
ENST00000319878 MI0003128 hsa-miR-511 GUGUCUUUUGCUCUGCAGUCA
ENST00000319878 MI0003575 hsa-miR-551b* GAAAUCAAGCGUGGGUGAGACC
ENST00000319878 MI0003592 hsa-miR-585 UGGGCGUAUCUGUAUGCUA
ENST00000319878 MI0003660 hsa-miR-645 UCUAGGCUGGUACUGCUGA
ENST00000319878 MI0003672 hsa-miR-663 AGGCGGGGCGCCGCGGGACCGC
ENST00000319878 MI0005559 hsa-miR-744 UGCGGGGCUAGGGCUAACAGCA
ENST00000319878 MI0003560 hsa-miR-92b* AGGGACGGGACGCGGUGCAGUG
ENST00000319878 MI0005757 hsa-miR-935 CCAGUUACCGCUUCCGCUACCGC
ENST00000319878 MI0000390 mmu-miR-292-5p ACUCAAACUGGGGGCUCUUUUG
ENST00000319878 MI0004553 mmu-miR-666-5p AGCGGGCACAGCUGUGAGAGCC
ENST00000319878 MI0004689 mmu-miR-705 GGUGGGAGGUGGGGUGGGCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

AAA36792   AAB23167   AAB69195   AAB86462   AAB86464   AAB86465   AAC13777   AAC50121   AAC99327   AAC99328   AAD14781   AAD26572   AAD26573   AAD26574   AAD26575   AAD26576   AAD26577   AAD26578   AAD26579   AAD26580   AAD26581   AAD26582   AAD26583   AAD26584   AAD51648   AAD51649   AAD51651   AAD51652   AAF07060   AAF13183   AAF13184   AAH69595   AAH69814   AAI11576   AAL37338   AAL37339   AAL37340   AAL37341   AAL37342   AAL37343   AAL37344   AAL37345   AAL37346   AAL37347   AAL37348   AAL37349   AAL37350   AAL37351   AAL37352   AAN02512   AAP03430   AAP97075   AAQ04662   AAQ04663   AAR20996   AAR24575   AAR97889   AAR98522   AAS00500   AAS16482   AAT01605   AAT90439   AAU93390   AAW31606   AAW31607   AAX39008   AAX39009   AAX58609   AAX58612   AAX58613   AAY98421   AAY98422   AAY98423   AAZ28944   AAZ32763   AAZ32764   AAZ67147   ABC41115   ABC41116   ABC41117   ABC41118   ABC59309   ABC59310   ABD66591   ABY67384   ACN23166   ACP27632   BAA11584   BAA11585   BAA11586   BAA11587   BAA11588   BAA11589   BAA11590   BAA11591   BAA11592   BAA11593   BAA11594   BAB32654   BAB32655   BAB32656   BAB32657   BAB32658   BAB32659   BAD20714   BAD20715   BAD20716   BAD20717   BAD20718   BAD20719   BAD20720   BAD20721   BAD20722   BAD20723   BAD20724   BAD20725   BAD20726   BAD20727   BAG63563   CAA59233   CAB81776   CAB81777   CAB81778   CAB81779   CAD19818   CAD19819   CAD22451   CAD60209   CAD60210   CAD60211   CAD60212   CAD60213   CAD60214   CAD60215   CAD60216   CAD60217   CAD60218   CAD60219   CAD60221   CAD60222   CAD60223   CAD60224   CAD60225   CAD60226   CAD60235   CAD60237   CAD60239   CAD60240   CAI79116   CAJ00555   CAJ13827   CAJ77763   CAM28424   CAM34526   EAW88054   NP_065202   O14759   O15512   P16442   Q102J2   Q15951   Q207T9   Q2LFC5   Q2LFC6   Q2PJQ0   Q2PJQ1   Q2PJQ2   Q2PJQ3   Q2VU69   Q2VU70   Q3ZMG8   Q45FB1   Q45L90   Q45L91   Q4JGX0   Q4JGX1   Q4JGX2   Q4LAQ2   Q4VVG1   Q4VY24   Q538Y8   Q538Y9   Q56S51   Q56S52   Q56S53   Q56S55   Q5VJ25   Q679L5   Q67BB2   Q6IS73   Q6L635   Q6L636   Q6L637   Q6L638   Q6L639   Q6L640   Q6L641   Q6L643   Q6L644   Q6L645   Q6L647   Q6L648   Q6LCV2   Q6PNN6   Q6R5A7   Q6R5J3   Q6R675   Q70V10   Q70V12   Q70V13   Q70V15   Q70V16   Q70V22   Q70V24   Q70V25   Q70V26   Q70V29   Q70V31   Q70V32   Q70V33   Q70V35   Q70V37   Q70V39   Q70V41   Q7LCZ1   Q7Z535   Q8N3W8   Q8NFW0   Q8WWJ1   Q8WXY5   Q8WXY6   Q8WXY7   Q8WXY8   Q8WXY9   Q8WXZ0   Q8WXZ1   Q8WXZ2   Q8WXZ3   Q8WXZ4   Q8WXZ5   Q8WXZ6   Q8WXZ7   Q99477   Q99478   Q99479   Q99480   Q99481   Q99482   Q99483   Q99486   Q99488   Q9BQ97   Q9C087   Q9C088   Q9C089   Q9C090   Q9NPA6   Q9NY02   Q9UBW4   Q9UIR1   Q9UK42   Q9UMY7   Q9UMY8   Q9UP69   Q9UP70   Q9UQ62   Q9UQ63   Q9UQ64   Q9UQ65   Q9UQ66   Q9UQ67  

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Flavonoids
  • Flavonoids results in decreased expression of ABO mRNA
18035473

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Prostatic Neoplasms marker 17013881
Inflammation inferred via Flavonoids 17296493

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Tregouet DA, et al. (2009) "Common susceptibility alleles are unlikely to contribute as strongly as the FV and ABO loci to VTE risk: results from a GWAS approach." Blood. 113(21):5298-5303. PMID:19278955
  2. [ + ] Guo XS, et al. (2009) "[Correlation between ABO blood type gene and attention-deficit hyperactivity disorder in children.]" Zhongguo Dang Dai Er Ke Za Zhi. 11(5):371-373. PMID:19470260
  3. [ + ] Santovito A, et al. (2009) "Erythrocyte polymorphisms in five ethnic groups of Northern Cote d'Ivoire." Int J Immunogenet. 36(3):189-191. PMID:19490215
  4. [ + ] Wolpin BM, et al. (2009) "ABO blood group and the risk of pancreatic cancer." J Natl Cancer Inst. 101(6):424-431. PMID:19276450
  5. [ + ] Taylor-Cousar JL, et al. (2009) "Histo-blood group gene polymorphisms as potential genetic modifiers of infection and cystic fibrosis lung disease severity." PLoS One. 4(1):e4270. PMID:19169360
  6. [ + ] Pare G, et al. (2008) "Novel association of ABO histo-blood group antigen with soluble ICAM-1: results of a genome-wide association study of 6,578 women." PLoS Genet. 4(7):e1000118. PMID:18604267
  7. [ + ] Otmani N, et al. (2008) "Sex, age and ABO blood groups in chemotherapy-induced oropharyngeal mucositis." Minerva Stomatol. 57(10):505-509. PMID:19078892
  8. [ + ] Yabe M, et al. (2008) "Alpha 2A adrenergic receptor polymorphism is associated with plasma von Willebrand factor levels in a general population." Blood Coagul Fibrinolysis. 19(5):395-399. PMID:18600088
  9. [ + ] Lethagen S, et al. (2008) "Distribution of von Willebrand factor levels in young women with and without bleeding symptoms: influence of ABO blood group and promoter haplotypes." Thromb Haemost. 99(6):1013-1018. PMID:18521502
  10. [ + ] El-Zawahri MM, et al. (2008) "Molecular genotyping and frequencies of A1, A2, B, O1 and O2 alleles of the ABO blood group system in a Kuwaiti population." Int J Hematol. 87(3):303-309. PMID:18247104
  11. [ + ] Zhu F, et al. (2008) "A 425T>C mutation in the B allele for the ABO transferase is associated with the B3 phenotype in Han Chinese persons." Transfusion. 48(11):2476-2477. PMID:19054377
  12. [ + ] Novaretti MC, et al. (2008) "ABO genotyping in leukemia patients reveals new ABO variant alleles." Genet Mol Res. 7(1):87-94. PMID:18273824
  13. [ + ] Cai XH, et al. (2008) "Molecular genetic analysis for the B subgroup revealing two novel alleles in the ABO gene." Transfusion. 48(11):2442-2447. PMID:18680548
  14. [ + ] Fowkes FJ, et al. (2008) "Host erythrocyte polymorphisms and exposure to Plasmodium falciparum in Papua New Guinea." Malar J. 7():1. PMID:18173836
  15. [ + ] Clark P, et al. (2008) "The GOAL study: a prospective examination of the impact of factor V Leiden and ABO(H) blood groups on haemorrhagic and thrombotic pregnancy outcomes." Br J Haematol. 140(2):236-240. PMID:18028481
  16. [ + ] Singh MR, et al. (2008) "Genetic polymorphisms at three loci in two populations of Manipur, India." Anthropol Anz. 66(2):191-198. PMID:18712158
  17. [ + ] Liu CL, et al. (2008) "[ABO genotyping of han population in Beijing]" Zhongguo Shi Yan Xue Ye Xue Za Zhi. 16(2):425-428. PMID:18426679
  18. [ + ] Melzer D, et al. (2008) "A genome-wide association study identifies protein quantitative trait loci (pQTLs)." PLoS Genet. 4(5):e1000072. PMID:18464913
  19. [ + ] Thuresson B, et al. (2008) "ABO transcript levels in peripheral blood and erythropoietic culture show different allele-related patterns independent of the CBF/NF-Y enhancer motif and multiple novel allele-specific variations in the 5'- and 3'-noncoding regions." Transfusion. 48(3):493-504. PMID:18067502
  20. [ + ] Yuan X, et al. (2008) "Population-based genome-wide association studies reveal six loci influencing plasma levels of liver enzymes." Am J Hum Genet. 83(4):520-528. PMID:18940312
  21. [ + ] Chang CS, et al. (2008) "Molecular basis of the A2B in Taiwan." Int J Hematol. 88(2):127-133. PMID:18651204
  22. [ + ] Fry AE, et al. (2008) "Common variation in the ABO glycosyltransferase is associated with susceptibility to severe Plasmodium falciparum malaria." Hum Mol Genet. 17(4):567-576. PMID:18003641
  23. [ + ] Minano A, et al. (2008) "AB0 blood group and risk of venous or arterial thrombosis in carriers of factor V Leiden or prothrombin G20210A polymorphisms." Haematologica. 93(5):729-734. PMID:18387978
  24. [ + ] Vafa M, et al. (2008) "Multiplicity of Plasmodium falciparum infection in asymptomatic children in Senegal: relation to transmission, age and erythrocyte variants." Malar J. 7():17. PMID:18215251
  25. [ + ] Remberger M, et al. (2007) "Major ABO blood group mismatch increases the risk for graft failure after unrelated donor hematopoietic stem cell transplantation." Biol Blood Marrow Transplant. 13(6):675-682. PMID:17531777
  26. [ + ] Yang BC, et al. (2007) "Molecular polymorphism of O alleles in the Chinese Han population." Ann Clin Lab Sci. 37(1):71-74. PMID:17311872
  27. [ + ] Letts JA, et al. (2007) "The effect of heavy atoms on the conformation of the active-site polypeptide loop in human ABO(H) blood-group glycosyltransferase B." Acta Crystallogr D Biol Crystallogr. 63(Pt 8):860-865. PMID:17642512
  28. [ + ] Persson M, et al. (2007) "Structural effects of naturally occurring human blood group B galactosyltransferase mutations adjacent to the DXD motif." J Biol Chem. 282(13):9564-9570. PMID:17259183
  29. [ + ] Seltsam A, et al. (2007) "Weak blood group B phenotypes may be caused by variations in the CCAAT-binding factor/NF-Y enhancer region of the ABO gene." Transfusion. 47(12):2330-2335. PMID:17764507
  30. [ + ] Krithika S, et al. (2007) "Intertribal and temporal allele-frequency variation at the ABO locus among Tibeto-Burman-speaking Adi subtribes of Arunachal Pradesh, India." Hum Biol. 79(3):355-362. PMID:18078207
  31. [ + ] Morelli VM, et al. (2007) "ABO blood group genotypes, plasma von Willebrand factor levels and loading of von Willebrand factor with A and B antigens." Thromb Haemost. 97(4):534-541. PMID:17393014
  32. [ + ] Martinez H, et al. (2007) "Admixture estimates for Caracas, Venezuela, based on autosomal, Y-chromosome, and mtDNA markers." Hum Biol. 79(2):201-213. PMID:18027815
  33. [ + ] Davies JA, et al. (2007) "Effect of von Willebrand factor Y/C1584 on in vivo protein level and function and interaction with ABO blood group." Blood. 109(7):2840-2846. PMID:17119126
  34. [ + ] Liu HM, et al. (2007) "A Novel Ael allele derived from a unique 816insG in Exon 7 of the ABO gene." J Formos Med Assoc. 106(11):969-974. PMID:18063521
  35. [ + ] Yu Q, et al. (2007) "[Study on ABO gene polymorphism in Uighur nationality in Xinjiang of China]" Zhonghua Yi Xue Yi Chuan Xue Za Zhi. 24(6):652-655. PMID:18067076
  36. [ + ] Pruissen DM, et al. (2007) "Haemostatic genetic variants, ABO blood group and bleeding risk during oral anticoagulant treatment after cerebral ischaemia of arterial origin." J Neurol. 254(12):1660-1665. PMID:17994314
  37. [ + ] Viel KR, et al. (2007) "A sequence variation scan of the coagulation factor VIII (FVIII) structural gene and associations with plasma FVIII activity levels." Blood. 109(9):3713-3724. PMID:17209060
  38. [ + ] Yip SP, et al. (2006) "ABO blood group in Kuwaitis: detailed allele frequency distribution and identification of novel alleles." Transfusion. 46(5):773-779. PMID:16686845
  39. [ + ] Ukaejiofo EO, et al. (2006) "Association between ABO, Rhesus blood group systems and haemoglobin genotype among confirmed HIV/AIDS-TB co-infected patients in Enugu Urban, Nigeria." West Afr J Med. 25(1):61-64. PMID:16722361
  40. [ + ] Marchetti G, et al. (2006) "Contribution of low density lipoprotein receptor-related protein genotypes to coagulation factor VIII levels in thrombotic women." Haematologica. 91(9):1261-1263. PMID:16956829
  41. [ + ] Uchida H, et al. (2006) "Lactobacilli binding human A-antigen expressed in intestinal mucosa." Res Microbiol. 157(7):659-665. PMID:16631357
  42. [ + ] Jenkins PV, et al. (2006) "ABO blood group determines plasma von Willebrand factor levels: a biologic function after all?" Transfusion. 46(10):1836-1844. PMID:17002642
  43. [ + ] Song SH, et al. (2006) "[Analysis for Eight ABO Alleles in Korean Population.]" Korean J Lab Med. 26(5):374-379. PMID:18156754
  44. [ + ] Jeremiah ZA, et al. (2006) "Abnormal haemoglobin variants, ABO and Rh blood groups among student of African descent in Port Harcourt, Nigeria." Afr Health Sci. 6(3):177-181. PMID:17140342
  45. [ + ] Twu YC, et al. (2006) "Expression of the histo-blood group B gene predominates in AB-genotype cells." Transfusion. 46(11):1988-1996. PMID:17076855
  46. [ + ] Tripathy V, et al. (2006) "ABO and Rh D polymorphism among Tibetans in India." Hum Biol. 78(2):229-233. PMID:17036929
  47. [ + ] Migot-Nabias F, et al. (2006) "Red blood cell polymorphisms in relation to Plasmodium falciparum asymptomatic parasite densities and morbidity in Senegal." Microbes Infect. 8(9-10):2352-2358. PMID:16859949
  48. [ + ] Deng ZH, et al. (2006) "Characterization of a novel B(A) allele with BBBA type at the ABO blood group." J Hum Genet. 51(8):732-736. PMID:16871363