Abcb11 | GeneID:27413 | Mus musculus
Gene Summary
[
] NCBI Entrez Gene
| Gene ID | 27413 | Official Symbol | Abcb11 |
|---|---|---|---|
| Locus | RP23-451M16.2 | Gene Type | protein-coding |
| Synonyms | ABC16; Bsep; Lith1; PFIC2; PGY4; SPGP | ||
| Full Name | ATP-binding cassette, sub-family B (MDR/TAP), member 11 | ||
| Description | ATP-binding cassette, sub-family B (MDR/TAP), member 11 | ||
| Chromosome | 2 C2|2 38.4 cM | ||
| Also Known As | ATP-binding cassette, sub-family B, member 11; OTTMUSP00000013989; OTTMUSP00000013990; bile salt export pump; sister of P-glycoprotein | ||
| Summary | The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is the major canalicular bile salt transporter in humans and mice. Mutations in the human gene cause a form of progressive familial intrahepatic cholestases which are a group of inherited disorders with severe cholestatic liver disease from early infancy. [provided by RefSeq] | ||
Orthologs and Paralogs
[
] Homologs - NCBI's HomoloGene Group: 74509
| ID | Symbol | Protein | Species |
|---|---|---|---|
| GeneID:8647 | ABCB11 | NP_003733.2 | Homo sapiens |
| GeneID:27413 | Abcb11 | NP_066302.2 | Mus musculus |
| GeneID:470717 | ABCB11 | XP_526100.2 | Pan troglodytes |
| GeneID:488390 | ABCB11 | XP_545512.2 | Canis lupus familiaris |
| GeneID:531150 | ABCB11 | XP_609636.3 | Bos taurus |
| GeneID:570936 | LOC570936 | XP_699562.3 | Danio rerio |
| GeneID:571189 | LOC571189 | XP_001923538.1 | Danio rerio |
| GeneID:4324720 | Os01g0723800 | NP_001044110.1 | Oryza sativa |
Antibodies
[
] Monoclonal and Polyclonal Antibodies
| No. | Provider | Product No. | Description |
|---|---|---|---|
| 1 | abcam | ab71793 | ABCB11 antibody - Carboxyterminal end (ab71793); Rabbit polyclonal to ABCB11 - Carboxyterminal end |
Gene Classification
[
] Gene Ontology
| ID | Category | GO Term |
|---|---|---|
| GO:0045177 | Component | apical part of cell |
| GO:0016021 | Component | integral to membrane |
| GO:0046581 | Component | intercellular canaliculus |
| GO:0016020 | Component | membrane |
| GO:0005624 | Component | membrane fraction |
| GO:0016887 | Function | ATPase activity |
| GO:0042626 | Function | ATPase activity, coupled to transmembrane movement of substances |
| GO:0005524 | Function | ATP binding |
| GO:0017111 | Function | nucleoside-triphosphatase activity |
| GO:0000166 | Function | nucleotide binding |
| GO:0006810 | Process | transport |
MicroRNA and Targets
[
] MicroRNA Sequences and Transcript Targets from miRBase at Sanger
| RNA Target | miRNA # | mat miRNA | Mature miRNA Sequence |
|---|---|---|---|
| ENSMUST00000102709 | MI0000240 | hsa-miR-198 | GGUCCAGAGGGGAGAUAGGUUC |
| ENSMUST00000102709 | MI0000779 | hsa-miR-371-5p | ACUCAAACUGUGGGGGCACU |
| ENSMUST00000102709 | MI0003170 | hsa-miR-518a-5p | CUGCAAAGGGAAGCCCUUUC |
| ENSMUST00000102709 | MI0003173 | hsa-miR-518a-5p | CUGCAAAGGGAAGCCCUUUC |
| ENSMUST00000102709 | MI0005768 | hsa-miR-943 | CUGACUGUUGCCGUCCUCCAG |
| ENSMUST00000102709 | MI0000692 | mmu-miR-100 | AACCCGUAGAUCCGAACUUGUG |
| ENSMUST00000102709 | MI0000153 | mmu-miR-126-3p | UCGUACCGUGAGUAAUAAUGCG |
| ENSMUST00000102709 | MI0000153 | mmu-miR-126-5p | CAUUAUUACUUUUGGUACGCG |
| ENSMUST00000102709 | MI0000693 | mmu-miR-139-3p | UGGAGACGCGGCCCUGUUGGAG |
| ENSMUST00000102709 | MI0000228 | mmu-miR-186* | GCCCUAAGGUGAAUUUUUUGGG |
| ENSMUST00000102709 | MI0000567 | mmu-miR-18a* | ACUGCCCUAAGUGCUCCUUCUG |
| ENSMUST00000102709 | MI0000250 | mmu-miR-207 | GCUUCUCCUGGCUCUCCUCCCUC |
| ENSMUST00000102709 | MI0000700 | mmu-miR-218 | UUGUGCUUGAUCUAACCAUGU |
| ENSMUST00000102709 | MI0000701 | mmu-miR-218 | UUGUGCUUGAUCUAACCAUGU |
| ENSMUST00000102709 | MI0000690 | mmu-miR-28* | CACUAGAUUGUGAGCUGCUGGA |
| ENSMUST00000102709 | MI0000393 | mmu-miR-295* | ACUCAAAUGUGGGGCACACUUC |
| ENSMUST00000102709 | MI0000400 | mmu-miR-300 | UAUGCAAGGGCAAGCUCUCUUC |
| ENSMUST00000102709 | MI0000643 | mmu-miR-351 | UCCCUGAGGAGCCCUUUGAGCCUG |
| ENSMUST00000102709 | MI0002399 | mmu-miR-464 | UACCAAGUUUAUUCUGUGAGAUA |
| ENSMUST00000102709 | MI0002405 | mmu-miR-470* | AACCAGUACCUUUCUGAGAAGA |
| ENSMUST00000102709 | MI0004636 | mmu-miR-497 | CAGCAGCACACUGUGGUUUGUA |
| ENSMUST00000102709 | MI0003517 | mmu-miR-546 | AUGGUGGCACGGAGUC |
| ENSMUST00000102709 | MI0003523 | mmu-miR-547 | CUUGGUACAUCUUUGAGUGAG |
| ENSMUST00000102709 | MI0004650 | mmu-miR-686 | AUUGCUUCCCAGACGGUGAAGA |
| ENSMUST00000102709 | MI0005206 | mmu-miR-742 | GAAAGCCACCAUGCUGGGUAAA |
| ENSMUST00000102709 | MI0005473 | mmu-miR-880 | UACUCCAUCCUCUCUGAGUAGA |
| ENSMUST00000102709 | MI0000146 | mmu-miR-99a | AACCCGUAGAUCCGAUCUUGUG |
| ENSMUST00000102710 | MI0000240 | hsa-miR-198 | GGUCCAGAGGGGAGAUAGGUUC |
| ENSMUST00000102710 | MI0000779 | hsa-miR-371-5p | ACUCAAACUGUGGGGGCACU |
| ENSMUST00000102710 | MI0003170 | hsa-miR-518a-5p | CUGCAAAGGGAAGCCCUUUC |
| ENSMUST00000102710 | MI0003173 | hsa-miR-518a-5p | CUGCAAAGGGAAGCCCUUUC |
| ENSMUST00000102710 | MI0005768 | hsa-miR-943 | CUGACUGUUGCCGUCCUCCAG |
| ENSMUST00000102710 | MI0000692 | mmu-miR-100 | AACCCGUAGAUCCGAACUUGUG |
| ENSMUST00000102710 | MI0000153 | mmu-miR-126-3p | UCGUACCGUGAGUAAUAAUGCG |
| ENSMUST00000102710 | MI0000153 | mmu-miR-126-5p | CAUUAUUACUUUUGGUACGCG |
| ENSMUST00000102710 | MI0000163 | mmu-miR-137 | UUAUUGCUUAAGAAUACGCGUAG |
| ENSMUST00000102710 | MI0000693 | mmu-miR-139-3p | UGGAGACGCGGCCCUGUUGGAG |
| ENSMUST00000102710 | MI0000167 | mmu-miR-142-3p | UGUAGUGUUUCCUACUUUAUGGA |
| ENSMUST00000102710 | MI0000564 | mmu-miR-15a | UAGCAGCACAUAAUGGUUUGUG |
| ENSMUST00000102710 | MI0000228 | mmu-miR-186* | GCCCUAAGGUGAAUUUUUUGGG |
| ENSMUST00000102710 | MI0000567 | mmu-miR-18a* | ACUGCCCUAAGUGCUCCUUCUG |
| ENSMUST00000102710 | MI0000237 | mmu-miR-195 | UAGCAGCACAGAAAUAUUGGC |
| ENSMUST00000102710 | MI0000250 | mmu-miR-207 | GCUUCUCCUGGCUCUCCUCCCUC |
| ENSMUST00000102710 | MI0000700 | mmu-miR-218 | UUGUGCUUGAUCUAACCAUGU |
| ENSMUST00000102710 | MI0000701 | mmu-miR-218 | UUGUGCUUGAUCUAACCAUGU |
| ENSMUST00000102710 | MI0000702 | mmu-miR-219 | UGAUUGUCCAAACGCAAUUCU |
| ENSMUST00000102710 | MI0000741 | mmu-miR-219 | UGAUUGUCCAAACGCAAUUCU |
| ENSMUST00000102710 | MI0000578 | mmu-miR-27a | UUCACAGUGGCUAAGUUCCGC |
| ENSMUST00000102710 | MI0000142 | mmu-miR-27b | UUCACAGUGGCUAAGUUCUGC |
| ENSMUST00000102710 | MI0000690 | mmu-miR-28* | CACUAGAUUGUGAGCUGCUGGA |
| ENSMUST00000102710 | MI0000393 | mmu-miR-295* | ACUCAAAUGUGGGGCACACUUC |
| ENSMUST00000102710 | MI0000143 | mmu-miR-29b | UAGCACCAUUUGAAAUCAGUGUU |
| ENSMUST00000102710 | MI0000712 | mmu-miR-29b | UAGCACCAUUUGAAAUCAGUGUU |
| ENSMUST00000102710 | MI0000400 | mmu-miR-300 | UAUGCAAGGGCAAGCUCUCUUC |
| ENSMUST00000102710 | MI0000643 | mmu-miR-351 | UCCCUGAGGAGCCCUUUGAGCCUG |
| ENSMUST00000102710 | MI0003535 | mmu-miR-369-5p | AGAUCGACCGUGUUAUAUUCGC |
| ENSMUST00000102710 | MI0002399 | mmu-miR-464 | UACCAAGUUUAUUCUGUGAGAUA |
| ENSMUST00000102710 | MI0002405 | mmu-miR-470* | AACCAGUACCUUUCUGAGAAGA |
| ENSMUST00000102710 | MI0004636 | mmu-miR-497 | CAGCAGCACACUGUGGUUUGUA |
| ENSMUST00000102710 | MI0003517 | mmu-miR-546 | AUGGUGGCACGGAGUC |
| ENSMUST00000102710 | MI0003523 | mmu-miR-547 | CUUGGUACAUCUUUGAGUGAG |
| ENSMUST00000102710 | MI0004611 | mmu-miR-674 | GCACUGAGAUGGGAGUGGUGUA |
| ENSMUST00000102710 | MI0004650 | mmu-miR-686 | AUUGCUUCCCAGACGGUGAAGA |
| ENSMUST00000102710 | MI0004694 | mmu-miR-710 | CCAAGUCUUGGGGAGAGUUGAG |
| ENSMUST00000102710 | MI0005206 | mmu-miR-742 | GAAAGCCACCAUGCUGGGUAAA |
| ENSMUST00000102710 | MI0005470 | mmu-miR-743b-3p | GAAAGACAUCAUGCUGAAUAGA |
| ENSMUST00000102710 | MI0005473 | mmu-miR-880 | UACUCCAUCCUCUCUGAGUAGA |
| ENSMUST00000102710 | MI0000146 | mmu-miR-99a | AACCCGUAGAUCCGAUCUUGUG |
Selected Publications
[
] Gene-related publications indexed at PubMed
- [
] Imai S, et al. (2009) "Analysis of DNA methylation and histone modification profiles of liver-specific transporters." Mol Pharmacol. 75(3):568-576. PMID:19047482 - [
] Paulusma CC, et al. (2009) "Activity of the bile salt export pump (ABCB11) is critically dependent on canalicular membrane cholesterol content." J Biol Chem. 284(15):9947-9954. PMID:19228692 - [
] Yska MJ, et al. (2008) "The role of bile salt toxicity in the pathogenesis of bile duct injury after non-heart-beating porcine liver transplantation." Transplantation. 85(11):1625-1631. PMID:18551070 - [
] Cheng X, et al. (2007) "Regulation of hepatic bile acid transporters Ntcp and Bsep expression." Biochem Pharmacol. 74(11):1665-1676. PMID:17897632 - [
] Huls M, et al. (2006) "ABC transporter expression profiling after ischemic reperfusion injury in mouse kidney." Kidney Int. 69(12):2186-2193. PMID:16612327 - [
] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072 - [
] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073 - [
] Lam P, et al. (2005) "Bile acid transport in sister of P-glycoprotein (ABCB11) knockout mice." Biochemistry. 44(37):12598-12605. PMID:16156672 - [
] Henkel A, et al. (2005) "Mice overexpressing hepatic Abcb11 rapidly develop cholesterol gallstones." Mamm Genome. 16(12):903-908. PMID:16341669 - [
] Figge A, et al. (2004) "Hepatic overexpression of murine Abcb11 increases hepatobiliary lipid secretion and reduces hepatic steatosis." J Biol Chem. 279(4):2790-2799. PMID:14570929 - [
] Plass JR, et al. (2004) "A progressive familial intrahepatic cholestasis type 2 mutation causes an unstable, temperature-sensitive bile salt export pump." J Hepatol. 40(1):24-30. PMID:14672610 - [
] Klett EL, et al. (2004) "A mouse model of sitosterolemia: absence of Abcg8/sterolin-2 results in failure to secrete biliary cholesterol." BMC Med. 2():5. PMID:15040800 - [
] Kamiya A, et al. (2004) "TNF-alpha regulates mouse fetal hepatic maturation induced by oncostatin M and extracellular matrices." Hepatology. 40(3):527-536. PMID:15349890 - [
] Perwaiz S, et al. (2003) "Appearance of atypical 3 alpha,6 beta,7 beta,12 alpha-tetrahydroxy-5 beta-cholan-24-oic acid in spgp knockout mice." J Lipid Res. 44(3):494-502. PMID:12562825 - [
] Wang R, et al. (2003) "Severe cholestasis induced by cholic acid feeding in knockout mice of sister of P-glycoprotein." Hepatology. 38(6):1489-1499. PMID:14647060 - [
] Hoda F, et al. (2003) "Hepatic canalicular membrane transport of bile salt in C57L/J and AKR/J mice: implications for cholesterol gallstone formation." J Membr Biol. 196(1):9-14. PMID:14724752 - [
] Phan J, et al. (2002) "The Diet1 locus confers protection against hypercholesterolemia through enhanced bile acid metabolism." J Biol Chem. 277(1):469-477. PMID:11682476 - [
] Kikuchi S, et al. (2002) "Radixin deficiency causes conjugated hyperbilirubinemia with loss of Mrp2 from bile canalicular membranes." Nat Genet. 31(3):320-325. PMID:12068294 - [
] Wolters H, et al. (2002) "Effects of bile salt flux variations on the expression of hepatic bile salt transporters in vivo in mice." J Hepatol. 37(5):556-563. PMID:12399219 - [
] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851 - [
] Wang R, et al. (2001) "Targeted inactivation of sister of P-glycoprotein gene (spgp) in mice results in nonprogressive but persistent intrahepatic cholestasis." Proc Natl Acad Sci U S A. 98(4):2011-2016. PMID:11172067 - [
] Lammert F, et al. (2001) "Chromosomal organization of candidate genes involved in cholesterol gallstone formation: a murine gallstone map." Gastroenterology. 120(1):221-238. PMID:11208732 - [
] Kawai J, et al. (2001) "Functional annotation of a full-length mouse cDNA collection." Nature. 409(6821):685-690. PMID:11217851 - [
] Shih DQ, et al. (2001) "Hepatocyte nuclear factor-1alpha is an essential regulator of bile acid and plasma cholesterol metabolism." Nat Genet. 27(4):375-382. PMID:11279518 - [
] Green RM, et al. (2000) "Molecular cloning and characterization of the murine bile salt export pump." Gene. 241(1):117-123. PMID:10607905 - [
] Schriml LM, et al. (2000) "Identification of 18 mouse ABC genes and characterization of the ABC superfamily in Mus musculus." Genomics. 64(1):24-31. PMID:10708515 - [
] Carninci P, et al. (2000) "Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes." Genome Res. 10(10):1617-1630. PMID:11042159 - [
] Paigen B, et al. (2000) "Quantitative trait loci mapping for cholesterol gallstones in AKR/J and C57L/J strains of mice." Physiol Genomics. 4(1):59-65. PMID:11074014 - [
] Shibata K, et al. (2000) "RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer." Genome Res. 10(11):1757-1771. PMID:11076861 - [
] Carninci P, et al. (1999) "High-efficiency full-length cDNA cloning." Methods Enzymol. 303():19-44. PMID:10349636 - [
] Bouchard G, et al. (1999) "High-resolution maps of the murine Chromosome 2 region containing the cholesterol gallstone locus, Lith1." Mamm Genome. 10(11):1070-1074. PMID:10556425
Tissue-specific expression of transporters is tightly linked with their physiological functions through the regulation of the membrane transport of their substrates. We hypothesized that epigenetic regulation underlies the tissue-specific expression of mouse liver-specific transporters (Oatp1b2/Slco1b2, Ntcp/Slc10a1, Bsep/Abcb11, and Abcg5/g8). We examined their DNA methylation and histone modification profiles near the transcriptional start site (TSS) in the liver, kidney, and cerebrum. Genome-wide DNA methylation profiling with tissue-dependent differentially methylated region profiling with restriction tag-mediated amplification and subsequent bisulfite genomic sequencing demonstrated that the CpG dinucleotides around the TSS of Oatp1b2 (from -515 to +149 CpGs), Ntcp (from -481 to +495 CpGs), Bsep (from -339 to +282 CpGs), and Abcg5/g8 (from -161 to +5 CpGs for Abcg5, i.e., from -213 to -48 CpGs for Abcg8) were hypomethylated in the liver and hypermethylated in the kidney and cerebrum. The opposite pattern was observed for Pept2/Slc15a2 (from -638 to +4 CpGs), which was expressed in the kidney and cerebrum but not in the liver. These DNA methylation profiles are consistent with the tissue distribution of these transporters. A chromatin immunoprecipitation assay demonstrated that the histone H3 associated with Oatp1b2, Ntcp, Bsep, and Abcg5/g8 promoters was hyperacetylated in the liver but was acetylated very little in the kidney and cerebrum, whereas the upstream region of Pept2 was hyperacetylated only in the kidney and cerebrum. These results suggest the involvement of epigenetic systems in the tissue-specific expression of mouse transporters Oatp1b2, Ntcp, Bsep, Abcg5/g8, and Pept2.
Mutations in ATP8B1 cause severe inherited liver disease. The disease is characterized by impaired biliary bile salt excretion (cholestasis), but the mechanism whereby impaired ATP8B1 function results in cholestasis is poorly understood. ATP8B1 is a type 4 P-type ATPase and is a flippase for phosphatidylserine. Atp8b1-deficient mice display a dramatic increase in the biliary extraction of cholesterol from the canalicular (apical) membrane of the hepatocyte. Here we studied the hypothesis that disproportionate cholesterol extraction from the canalicular membrane impairs the activity of the bile salt transporter, ABCB11, and as a consequence causes cholestasis. Using single pass liver perfusions, we show that not only ABCB11-mediated transport but also Abcc2-mediated transport were reduced at least 4-fold in Atp8b1 deficiency. We show that canalicular membranes of cholestatic Atp8b1-deficient mice have a dramatically reduced cholesterol to phospholipid ratio, i.e. 0.75 +/- 0.24 versus 2.03 +/- 0.71 for wild type. In vitro depletion of cholesterol from mouse liver plasma membranes using methyl-beta-cyclodextrin demonstrated a near linear relation between cholesterol content of the membranes and ATP-dependent taurocholate transport. Abcc2-mediated transport activity was not affected up to 30% of membrane cholesterol depletion but declined to negligible levels at 70% of membrane cholesterol depletion. These effects were reversible as cholesterol repletion of the liver membranes completely restored Abcb11- and Abcc2-mediated transport. Our data demonstrate that membrane cholesterol content is a critical determinant of ABCB11/ABCC2 transport activity, provide an explanation for the etiology of ATP8B1 disease, and suggest a novel mechanism protecting the canalicular membrane against luminal bile salt overload.
BACKGROUND: Intrahepatic bile duct strictures are a serious complication after non-heart-beating (NHB) liver transplantation. Bile salt toxicity has been identified as an important factor in the pathogenesis of bile duct injury and cholangiopathies. The role of bile salt toxicity in the development of biliary strictures after NHB liver transplantation is unclear. METHODS: In a porcine model of NHB liver transplantation, we studied the effect of different periods of warm ischemia in the donor on bile composition and subsequent bile duct injury after transplantation. After induction of cardiac arrest in the donor, liver procurement was delayed for 0 min (group A), 15 min (group B), or more or equal to 30 min (group C). Livers were subsequently transplanted after 4 hr of cold preservation. In the recipients, bile flow was measured, and bile samples were collected daily to determine the bile salt-to-phospholipid ratio. Severity of bile duct injury was semiquantified by using a histologic grading scale. RESULTS: Posttransplantation survival was directly related to the duration of warm ischemia in the donor. The bile salt-to-phospholipid ratio in bile produced early after transplantation was significantly higher in group C, compared with group A and B. Histopathologic condition showed the highest degree of bile duct injury in group C. CONCLUSION: Prolonged warm ischemia in NHB donors is associated with the formation of toxic bile after transplantation, with a high biliary bile salt-to-phospholipid ratio. These data suggest that bile salt toxicity contributes to the pathogenesis of bile duct injury after NHB liver transplantation.
Sodium-taurocholate cotransporting polypeptide (Ntcp) and bile salt export pump (Bsep) are two key transporters for hepatic bile acid uptake and excretion. Alterations in Ntcp and Bsep expression have been reported in pathophysiological conditions. In the present study, the effects of age, gender, and various chemicals on the regulation of these two transporters were characterized in mice. Ntcp and Bsep mRNA levels in mouse liver were low in the fetus, but increased to its highest expression at parturition. After birth, mouse Ntcp and Bsep mRNA decreased by more than 50%, and then gradually increased to adult levels by day 30. Expression of mouse Ntcp mRNA and protein exhibit higher levels in female than male livers. No gender difference exists in BSEP/Bsep expression in human and mouse livers. Hormone replacements conducted in gonadectomized, hypophysectomized, and lit/lit mice indicate that female-predominant Ntcp expression in mouse liver is due to the inhibitory effect of male-pattern GH secretion, but not sex hormones. Ntcp and Bsep expression are in general resistant to induction by a large battery of microsomal enzyme inducers. Administration of cholestyramine increased Ntcp, whereas chenodeoxycholic acid (CDCA) increased Bsep mRNA expression. In conclusion, mouse Ntcp and Bsep are regulated by age, gender, cholestyramine, and bile acid, but resistant to induction by most microsomal enzyme inducers.
Renal ATP binding cassette (ABC) transporters have an important role in the elimination of metabolic waste products and compounds foreign to the body. The kidney has the ability to tightly control the expression of these efflux transporters to maintain homeostasis, and as a major mechanism of adaptation to environmental stress. In the present study, we investigated the expression of 45 ABC transporter genes in the mouse kidney under basal conditions, after induction of ischemia and after regeneration. Two days after clamping, mice showed a 76% decrease in renal creatinine clearance, which improved clearly within 7 days. This was confirmed by histological examinations. Seven days after ischemia, real-time quantitative Polymerase chain reaction data showed that transcript abundance of abcb1, abcb11, and abcc4 was increased, and that of abca3, abcc2, and abcg2 decreased. Expression of all transporters returned to baseline after 14 days, except for abcb11, which was reduced. Abcb11 is the major liver canalicular bile salt export pump. Here we show for the first time expression in the kidney and localization of the transporter to the apical membrane of proximal tubules. The presence of another novel renal transporter, abca3, was confirmed by Western blotting. Immunohistochemistry showed that abca3 is localized to the peritubular capillaries and apical membrane of proximal tubules. In conclusion, after inducing ischemic reperfusion injury in the kidney, ABC transporters appear to be differentially regulated, which might be associated with the renal regeneration process. Furthermore, we showed for the first time expression and subcellular localization of abcb11 and abca3 in mouse kidney.
This study describes comprehensive polling of transcription start and termination sites and analysis of previously unidentified full-length complementary DNAs derived from the mouse genome. We identify the 5' and 3' boundaries of 181,047 transcripts with extensive variation in transcripts arising from alternative promoter usage, splicing, and polyadenylation. There are 16,247 new mouse protein-coding transcripts, including 5154 encoding previously unidentified proteins. Genomic mapping of the transcriptome reveals transcriptional forests, with overlapping transcription on both strands, separated by deserts in which few transcripts are observed. The data provide a comprehensive platform for the comparative analysis of mammalian transcriptional regulation in differentiation and development.
Antisense transcription (transcription from the opposite strand to a protein-coding or sense strand) has been ascribed roles in gene regulation involving degradation of the corresponding sense transcripts (RNA interference), as well as gene silencing at the chromatin level. Global transcriptome analysis provides evidence that a large proportion of the genome can produce transcripts from both strands, and that antisense transcripts commonly link neighboring "genes" in complex loci into chains of linked transcriptional units. Expression profiling reveals frequent concordant regulation of sense/antisense pairs. We present experimental evidence that perturbation of an antisense RNA can alter the expression of sense messenger RNAs, suggesting that antisense transcription contributes to control of transcriptional outputs in mammals.
In vertebrates, bile flow is essential for movement of water and solutes across liver canalicular membranes. In recent years, the molecular motor of canalicular bile acid secretion has been identified as a member of the ATP binding cassette transporter (ABC) superfamily, known as sister of P-glycoprotein (Spgp) or bile salt export pump (Bsep, ABCB11). In humans, mutations in the BSEP gene are associated with a very low level of bile acid secretion and severe cholestasis. However, as reported previously, because the spgp(-)(/)(-) knockout mice do not express severe cholestasis and have substantial bile acid secretion, we investigated the "alternative transport system" that allows these mice to be physiologically relatively normal. We examined the expression levels of several ABC transporters in spgp(-)(/)(-) mice and found that the level of multidrug resistance Mdr1 (P-glycoprotein) was strikingly increased while those of Mdr2, Mrp2, and Mrp3 were increased to only a moderate extent. We hypothesize that an elevated level of Mdr1 in the spgp(-)(/)(-) knockout mice functions as an alternative pathway to transport bile acids and protects hepatocytes from bile acid-induced cholestasis. In support of this hypothesis, we showed that plasma membrane vesicles isolated from a drug resistant cell line expressing high levels of P-glycoprotein were capable of transporting bile acids, albeit with a 5-fold lower affinity compared to Spgp. This finding is the first direct evidence that P-glycoprotein (Mdr1) is capable of transporting bile acids.
Cholelithiasis is a polygenic disease, although the genes responsible for gallstone formation have not yet been clearly identified. QTL analysis has identified the Lith 1 loci on mouse Chromosome 2, and the hepatic bile salt transporter Abcb11 maps to the Lith 1 locus. We have used recently developed TTR-Abcb11 transgenic mice that overexpress Abcb11 to determine the effects of Abcb11 overexpression on cholesterol gallstone formation. TTR-Abcb11 and FVB/NJ strain control mice were fed a lithogenic or chow diet and cholesterol crystal and gallstone formation were measured. Biliary lipids in gallbladder bile and gene expression of canalicular lipid transporters were also analyzed. TTR-Abcb11 mice fed a lithogenic diet had an increased rate of cholesterol crystal and gallstone formation. This was associated with an increase in both the hydrophobic bile salt and cholesterol content of gallbladder bile. Expression of Abcb4, Abcg5, and Abcg8 did not change before gallstone formation. These data indicate that hepatic overexpression of Abcb11 increases the rate of cholesterol gallstone formation. This is likely because of increases in bile salt hydrophobicity but not because of alterations of other biliary lipid transporters. These findings strongly support Abcb11 as a Lith 1 gene.
Abcb11 encodes for the liver bile salt export pump, which is rate-limiting for hepatobiliary bile salt secretion. We employed transthyretin-Abcb11 and BAC-Abcb11 transgenes to develop mice overexpressing the bile salt export pump in the liver. The mice manifest increases in bile flow and biliary secretion of bile salts, phosphatidylcholine, and cholesterol. Hepatic gene expression of cholesterol 7alpha-hydroxylase and ileal expression of the apical sodium bile salt transporter are markedly reduced, whereas gene expression of targets of the nuclear bile salt receptor FXR (ileal lipid-binding protein, short heterodimer partner (SHP) is increased. Because these changes in gene expression are associated with an increased overall hydrophobicity of the bile salt pool and a 4-fold increase of the FXR ligand taurodeoxycholate, they reflect bile salt-mediated regulation of FXR and SHP target genes. Despite the increased biliary secretion of bile salts, fecal bile salt excretion is unchanged, suggestive of an enhanced enterohepatic cycling of bile salts. Abcb11 transgenic mice fed a lithogenic (high cholesterol/fat/cholic acid) diet display markedly reduced hepatic steatosis compared with wild-type controls. We conclude that mice overexpressing Abcb11 display an increase in biliary bile salt secretion and taurodeoxycholate content, which is associated with FXR/SHP-mediated changes in hepatic and ileal gene expression. Because these mice are resistant to hepatic lipid accumulation, regulation of Abcb11 may be important for the pathogenesis and treatment of steatohepatitis.
BACKGROUND/AIMS: Progressive familial intrahepatic cholestasis type 2 (PFIC-2) patients have a defect in the hepatocanalicular bile salt secretion. The disease is caused by mutations in the bile salt export pump (BSEP). Ten different missense mutations have been described. In this study, we analysed the effect of the D482G PFIC-2 mutation on BSEP function. METHODS: Adenosine triphosphatase (ATPase) and taurocholate transport assays were performed with full-length mouse Bsep (mBsep) with and without the D482G mutation. The effect on expression and subcellular sorting was studied in HepG2 cells, stably expressing enhanced green fluorescent protein (EGFP)-tagged mBsep proteins. RESULTS: The D482G mutation did not significantly affect the taurocholate transport activity of mBsep, even though the bile salt-inducible ATPase activity of the mutant protein was slightly reduced. Protein expression and canalicular sorting were strongly affected by the D482G mutation. Mutant EGFP-mBsep protein was only partly glycosylated and detected in both the canalicular membrane and the cytoplasm. At 30 degrees C, the mutant mRNA and protein levels were strongly increased, and the protein was predominantly glycosylated and efficiently targeted to the canalicular membrane. CONCLUSIONS: These data suggest that PFIC-2 patients with the D482G mutation express a functional, but highly unstable, temperature-sensitive bile salt export pump.
BACKGROUND: Mutations in either of two genes comprising the STSL locus, ATP-binding cassette (ABC)-transporters ABCG5 (encoding sterolin-1) and ABCG8 (encoding sterolin-2), result in sitosterolemia, a rare autosomal recessive disorder of sterol trafficking characterized by increased plasma plant sterol levels. Based upon the genetics of sitosterolemia, ABCG5/sterolin-1 and ABCG8/sterolin-2 are hypothesized to function as obligate heterodimers. No phenotypic difference has yet been described in humans with complete defects in either ABCG5 or ABCG8. These proteins, based upon the defects in humans, are responsible for regulating dietary sterol entry and biliary sterol secretion. METHODS: In order to mimic the human disease, we created, by a targeted disruption, a mouse model of sitosterolemia resulting in Abcg8/sterolin-2 deficiency alone. Homozygous knockout mice are viable and exhibit sitosterolemia. RESULTS: Mice deficient in Abcg8 have significantly increased plasma and tissue plant sterol levels (sitosterol and campesterol) consistent with sitosterolemia. Interestingly, Abcg5/sterolin-1 was expressed in both liver and intestine in Abcg8/sterolin-2 deficient mice and continued to show an apical expression. Remarkably, Abcg8 deficient mice had an impaired ability to secrete cholesterol into bile, but still maintained the ability to secrete sitosterol. We also report an intermediate phenotype in the heterozygous Abcg8+/- mice that are not sitosterolemic, but have a decreased level of biliary sterol secretion relative to wild-type mice. CONCLUSION: These data indicate that Abcg8/sterolin-2 is necessary for biliary sterol secretion and that loss of Abcg8/sterolin-2 has a more profound effect upon biliary cholesterol secretion than sitosterol. Since biliary sitosterol secretion is preserved, although not elevated in the sitosterolemic mice, this observation suggests that mechanisms other than by Abcg8/sterolin-2 may be responsible for its secretion into bile.
Fetal hepatic maturation consists of multisteps and is regulated by several cytokines and cell-cell or cell-matrices interactions. In the mid-to-late fetal stage, hepatocytes have few metabolic functions associated with adult liver homeostasis. Cultured fetal hepatocytes acquire the expression of several mature liver-specific genes through stimulation with hepatic maturation factor oncostatin M (OSM) and matrigel. Tumor necrosis factor-alpha (TNFalpha) regulates fetal hepatic maturation stimulated by OSM and matrigel. TNFalpha suppressed expression of mature liver-specific genes such as tyrosine aminotransferase and apolipoproteins. In addition, the expression of hematopoietic cytokines and cyclin A2, repressed by OSM and matrigel, is induced by TNFalpha in the fetal hepatic cultures coincident with cell division. TNFalpha inhibited the induction of hepatocyte nuclear factor 4alpha induced by OSM and matrigel, suggesting that down-regulation of hepatocyte nuclear factor 4alpha expression is involved in the mechanism of suppression of hepatic maturation by TNFalpha. Interestingly, TNFalpha is expressed in the prenatal and postnatal liver but not in adult liver, whereas TNFR1, a TNFalpha receptor, is expressed in both fetal and adult livers. In conclusion, TNFalpha is a suppressive factor of hepatic maturation. The balance between hepatic maturation factor (OSM and extracellular matrices) and TNFalpha is important for liver development.
Bile formation and its canalicular secretion are essential functions of the mammalian liver. The sister-of-p-glycoprotein (spgp) gene was shown to encode the canalicular bile salt export protein, and mutations in spgp gene were identified as the cause of progressive familial intrahepatic cholestasis type 2. However, target inactivation of spgp gene in mice results in nonprogressive but persistent cholestasis and causes the secretion of unexpectedly large amounts of unknown tetrahydroxylated bile acid in the bile. The present study confirms the identity of this tetrahydroxylated bile acid as 3 alpha,6 beta,7 beta,12 alpha-tetrahydroxy-5 beta-cholan-24-oic acid. The data further show that in serum, liver, and urine of the spgp knockout mice, there is a significant increase in the concentration of total bile salts containing a large amount of tetrahydroxy-5 beta-cholan-24-oic acid. The increase in total bile acids was associated with up-regulation of the mRNA of cholesterol 7 alpha-hydroxylase in male mice only. It is suggested that the lower severity of the cholestasis in the spgp knockout mice may be due to the synthesis of 3 alpha,6 beta,7 beta,12 alpha-tetrahydroxy-5 beta-cholan-24-oic acid, which neutralizes in part the toxic effect of bile acids accumulated in the liver.
Intrahepatic cholestasis is often associated with impairment of biliary bile acid secretion, a process mediated by the sister of P-glycoprotein (Spgp or Abcb11) also known as the bile salt export pump (Bsep). In humans, mutations in the Spgp gene are associated with a fatal childhood disease, type 2 progressive familial intrahepatic cholestasis (PFIC2). However in mice, the "knockout" of Spgp only results in mild cholestasis. In this study, we fed spgp(-/-) knockout mice with a cholic acid (CA)-supplemented diet to determine whether a more pronounced PFIC2-like phenotype could be induced. Such mice developed severe cholestasis characterized by jaundice, weight loss, elevated plasma bile acid, elevated transaminase, cholangiopathy (proliferation of bile ductules and cholangitis), liver necrosis, high mortality, and wide-ranging changes in the mRNA expression of major liver genes (16/36 examined). A surprising observation was that the bile acid output and bile flow in CA-fed mutant mice was significantly higher than anticipated. This suggests that the spgp(-/-) mice are able to utilize an alternative bile salt transport system. However, unlike Spgp, this system is insufficient to protect the knockout mice from cholestasis despite its high capacity. In conclusion, the spgp(-/-) mice provide a unique model to investigate molecular pathways associated with cholestasis and related diseases.
C57L/J (gallstone-susceptible) and AKR/J (gallstone-resistant) mice have been utilized for quantitative trait loci (QTL) analysis to identify the Lith 1 locus for cholelithiasis. Abcb11 encodes for the liver canalicular membrane bile salt export pump (BSEP), which maps to this QTL and is a candidate gene for Lith 1. We investigated the transmembrane transport of taurocholate in canalicular liver membrane vesicles isolated from these murine strains. Canalicular liver plasma membranes (cLPM) and RNA were isolated from C57L/J and AKR/J mice livers, and were utilized for Northern and Western blot analysis and functional (3)H-taurocholate uptake studies. ATP-dependent (3)H-taurocholate uptake was significantly higher in AKR/J, compared to C57L/J mice. V(max) was 127 vs. 42 pmol TC/mg/s in the murine strains, respectively, while K(m) was unchanged. In contrast, gene and protein expression of hepatic Abcb11 was increased three-fold in C57L/J, compared to AKR/J mice. Thus, Abcb11 bile salt transport activity per unit protein was reduced nine-fold in the C57L/J, compared to AKR/J mice. In contrast, canalicular membrane cholesterol:phospholipid content was also significantly higher in the C57L/J mice. We conclude that gallstone-susceptible C57L/J mice demonstrate increased gene and canalicular membrane expression of Abcb11, however, taurocholate transport is functionally diminished. The latter may be due to the increased cholesterol membrane content of the cLPM in C57L/J mice. These findings may be important for the pathogenesis of gallstone formation.
The C57BL/6ByJ (B6By) mouse strain is resistant to diet-induced hypercholesterolemia and atherosclerosis, despite its near genetic identity with the atherosclerosis-susceptible C57BL/6J (B6J) strain. We previously identified a genetic locus, Diet1, which is responsible for the resistant phenotype in B6By mice. To investigate the function of Diet1, we compared mRNA expression profiles in the liver of B6By and B6J mice fed an atherogenic diet using a DNA microarray. These studies revealed elevated expression levels in B6By liver for key bile acid synthesis proteins, including cholesterol 7alpha-hydroxylase and sterol-27-hydroxylase, and the oxysterol nuclear receptor liver X receptor alpha. Expression levels for several other genes involved in bile acid metabolism were subsequently found to differ between B6By and B6J mice, including the bile acid receptor farnesoid X receptor, oxysterol 7alpha-hydroxylase, sterol-12alpha-hydroxylase, and hepatic bile acid transporters on both sinusoidal and canalicular membranes. The overall expression profile of the B6By strain suggests a higher rate of bile acid synthesis and transport in these mice. Consistent with this interpretation, fecal bile acid excretion is increased 2-fold in B6By mice, and bile acid levels in blood and urine are elevated 3- and 18-fold, respectively. Genetic analysis of serum bile acid levels revealed co-segregation with Diet1, indicating that this locus is likely responsible for both increased bile acid excretion and resistance to hypercholesterolemia in B6By mice.
The ezrin-radixin-moesin (ERM) family of proteins crosslink actin filaments and integral membrane proteins. Radixin (encoded by Rdx) is the dominant ERM protein in the liver of wildtype mice and is concentrated at bile canalicular membranes (BCMs). Here we show that Rdx(-/-) mice are normal at birth, but their serum concentrations of conjugated bilirubin begin to increase gradually around 4 weeks, and they show mild liver injury after 8 weeks. This phenotype is similar to human conjugated hyperbilirubinemia in Dubin-Johnson syndrome, which is caused by mutations in the multidrug resistance protein 2 (MRP2, gene symbol ABCC2), although this syndrome is not associated with overt liver injury. In wildtype mice, Mrp2 concentrates at BCMs to secrete conjugated bilirubin into bile. In the BCMs of Rdx(-/-) mice, Mrp2 is decreased compared with other BCM proteins such as dipeptidyl peptidase IV (CD26) and P-glycoproteins. In vitro binding studies show that radixin associates directly with the carboxy-terminal cytoplasmic domain of human MRP2. These findings indicate that radixin is required for secretion of conjugated bilirubin through its support of Mrp2 localization at BCMs.
BACKGROUND/AIMS: Expression of hepatic bile salt transporters is partly regulated by bile salts via activation of nuclear farnesoid X-activated receptor (Fxr). We investigated the physiological relevance of this regulation by evaluating transporter expression in mice experiencing different transhepatic bile salt fluxes. METHODS: Bile salt flux was manipulated by dietary supplementation with taurocholate (0.5% w/w) or cholestyramine (2% w/w) or by disruption of the cholesterol 7alpha-hydroxylase-gene (Cyp7A(-/-) mice) leading to reduced bile salt pool size. Expression of hepatic transporters was assessed (polymerase chain reaction (PCR), immunoblotting, and immunohistochemistry). RESULTS: Biliary bile salt secretion was increased (+350%) or decreased (-50%) after taurocholate or cholestyramine feeding, respectively, but plasma bile salt concentrations and hepatic Fxr expression were not affected. The bile salt uptake system Na(+)-taurocholate co-transporting polypeptide (Ntcp) and organic anion transporting polypeptide-1 (Oatp1) were down-regulated by taurocholate and not affected by cholestyramine feeding. Cyp7A(-/-) mice did not show altered Ntcp or Oatp1 expression. Canalicular bile salt export pump (Bsep) was up-regulated by 65% in taurocholate-fed mice, and slightly down-regulated in Cyp7A(-/-) mice. CONCLUSIONS: Large variations in hepatic bile salt flux have minor effects on expression of murine Ntcp and Bsep in vivo, suggesting that these transporters are abundantly expressed and able to accommodate a wide range of 'physiological' bile salt fluxes.
Only a small proportion of the mouse genome is transcribed into mature messenger RNA transcripts. There is an international collaborative effort to identify all full-length mRNA transcripts from the mouse, and to ensure that each is represented in a physical collection of clones. Here we report the manual annotation of 60,770 full-length mouse complementary DNA sequences. These are clustered into 33,409 'transcriptional units', contributing 90.1% of a newly established mouse transcriptome database. Of these transcriptional units, 4,258 are new protein-coding and 11,665 are new non-coding messages, indicating that non-coding RNA is a major component of the transcriptome. 41% of all transcriptional units showed evidence of alternative splicing. In protein-coding transcripts, 79% of splice variations altered the protein product. Whole-transcriptome analyses resulted in the identification of 2,431 sense-antisense pairs. The present work, completely supported by physical clones, provides the most comprehensive survey of a mammalian transcriptome so far, and is a valuable resource for functional genomics.
Mutations in the sister of P-glycoprotein (Spgp) or bile salt export pump (BSEP) are associated with Progressive Familial Intrahepatic Cholestasis (PFIC2). Spgp is predominantly expressed in the canalicular membranes of liver. Consistent with in vitro evidence demonstrating the involvement of Spgp in bile salt transport, PFIC2 patients secrete less than 1% of biliary bile salts compared with normal infants. The disease rapidly progresses to hepatic failure requiring liver transplantation before adolescence. In this study, we show that the knockout of spgp gene in mice results in intrahepatic cholestasis, but with significantly less severity than PFIC2 in humans. Some unexpected characteristics are observed. Notably, although the secretion of cholic acid in mutant mice is greatly reduced (6% of wild-type), total bile salt output in mutant mice is about 30% of wild-type. Also, secretion of an unexpectedly large amount of tetra-hydroxylated bile acids (not detected in wild-type) is observed. These results suggest that hydroxylation and an alternative canalicular transport mechanism for bile acids compensate for the absence of Spgp function and protect the mutant mice from severe cholestatic damage. In addition, the spgp(-/-) mice display a significant increase in the secretion of cholesterol and phospholipids into the bile. This latter observation in spgp(-/-) mice suggests that intrahepatic, rather than intracanalicular, bile salts are the major driving force for the biliary lipid secretion. The spgp(-/-) mice thus provide a unique model for gaining new insights into therapeutic intervention for intrahepatic cholestasis and understanding mechanisms associated with lipid homeostasis.
Epidemiologic and family studies indicate that cholesterol gallstone formation is in part genetically determined. The major contribution to our current understanding of gallstone genes derives from animal studies, particularly cross-breeding experiments in inbred mouse strains that differ in genetic susceptibility to cholesterol gallstone formation (quantitative trait loci mapping). In this review we summarize how the combined use of genomic strategies and phenotypic studies in inbred mice has proven to be a powerful means of dissecting the complex pathophysiology of this common disease. We present a "gallstone map" for the mouse, consisting of all genetic loci that have been identified to confer gallstone susceptibility as well as putative candidate genes. Translation of the genetic loci and genes between mouse and human predicts chromosomal regions in the human genome that are likely to harbor gallstone genes. Both the number and the precise understanding of gallstone genes are expected to further increase with rapid progress of the genome projects, and multiple new targets for early diagnosis and prevention of gallstone disease should become possible.
The RIKEN Mouse Gene Encyclopaedia Project, a systematic approach to determining the full coding potential of the mouse genome, involves collection and sequencing of full-length complementary DNAs and physical mapping of the corresponding genes to the mouse genome. We organized an international functional annotation meeting (FANTOM) to annotate the first 21,076 cDNAs to be analysed in this project. Here we describe the first RIKEN clone collection, which is one of the largest described for any organism. Analysis of these cDNAs extends known gene families and identifies new ones.
Maturity-onset diabetes of the young type 3 (MODY3) is caused by haploinsufficiency of hepatocyte nuclear factor-1alpha (encoded by TCF1). Tcf1-/- mice have type 2 diabetes, dwarfism, renal Fanconi syndrome, hepatic dysfunction and hypercholestrolemia. Here we explore the molecular basis for the hypercholesterolemia using oligonucleotide microchip expression analysis. We demonstrate that Tcf1-/- mice have a defect in bile acid transport, increased bile acid and liver cholesterol synthesis, and impaired HDL metabolism. Tcf1-/- liver has decreased expression of the basolateral membrane bile acid transporters Slc10a1, Slc21a3 and Slc21a5, leading to impaired portal bile acid uptake and elevated plasma bile acid concentrations. In intestine and kidneys, Tcf1-/- mice lack expression of the ileal bile acid transporter (Slc10a2), resulting in increased fecal and urinary bile acid excretion. The Tcf1 protein (also known as HNF-1alpha) also regulates transcription of the gene (Nr1h4) encoding the farnesoid X receptor-1 (Fxr-1), thereby leading to reduced expression of small heterodimer partner-1 (Shp-1) and repression of Cyp7a1, the rate-limiting enzyme in the classic bile acid biosynthesis pathway. In addition, hepatocyte bile acid storage protein is absent from Tcf1-/- mice. Increased plasma cholesterol of Tcf1-/- mice resides predominantly in large, buoyant, high-density lipoprotein (HDL) particles. This is most likely due to reduced activity of the HDL-catabolic enzyme hepatic lipase (Lipc) and increased expression of HDL-cholesterol esterifying enzyme lecithin:cholesterol acyl transferase (Lcat). Our studies demonstrate that Tcf1, in addition to being an important regulator of insulin secretion, is an essential transcriptional regulator of bile acid and HDL-cholesterol metabolism.
Hepatic bile salt secretion and bile formation are essential functions of the mammalian liver, and the rate-limiting step of hepatocellular secretion of bile salts is canalicular secretion. Recently, the rat sister-of-p-glycoprotein/bile salt export pump (spgp/BSEP) was demonstrated to encode for the rat ATP-dependent canalicular bile salt export protein, and mutations of human BSEP were identified as the cause of PFIC 2. Since mouse models are vital for studies in hepatocellular transport and metabolism, cloning and characterization of the murine gene are essential. In this study, we have cloned a full-length, functional cDNA for the mBsep. The deduced amino acid sequence encodes for a 1321-amino-acid protein and is 94% similar to rat and 89% similar to human bsep. Western immunoblotting using an antibody directed against a carboxy-terminal peptide of mbsep protein reveals a 160kDa protein, which is highly enriched in mouse canalicular membranes. Transfection of mBSEP into Sf-9 insect cells or mammalian Balb-3T3 cells confers functional transport of the bile salt taurocholate. The mBsep mRNA is expressed in murine liver, but not in other tissues. Hepatic mBsep levels appear highly regulated, being markedly diminished in both LPS and estrogen models of cholestasis. These data are important for further murine studies of hepatocellular transport physiology and metabolism.
ATP-binding cassette (ABC) genes encode a family of transport proteins known to be involved in a number of human genetic diseases. In this study, we characterized the ABC superfamily in Mus musculus through in silico gene identification and mapping and phylogenetic analysis of mouse and human ABC genes. By querying dbEST with amino acid sequences from the conserved ATP-binding domains, we identified and partially sequenced 18 new mouse ABC genes, bringing the total number of mouse ABC genes to 34. Twelve of the new ABC genes were mapped in the mouse genome to the X chromosome and to 10 of the 19 autosomes. Phylogenetic relationships of mouse and human ABC genes were examined with maximum parsimony and neighbor-joining analyses that demonstrated that mouse and human ABC orthologs are more closely related than are mouse paralogs. The mouse ABC genes could be grouped into the seven previously described human ABC subfamilies. Three mouse ABC genes mapped to regions implicated in cholesterol gallstone susceptibility.
In the effort to prepare the mouse full-length cDNA encyclopedia, we previously developed several techniques to prepare and select full-length cDNAs. To increase the number of different cDNAs, we introduce here a strategy to prepare normalized and subtracted cDNA libraries in a single step. The method is based on hybridization of the first-strand, full-length cDNA with several RNA drivers, including starting mRNA as the normalizing driver and run-off transcripts from minilibraries containing highly expressed genes, rearrayed clones, and previously sequenced cDNAs as subtracting drivers. Our method keeps the proportion of full-length cDNAs in the subtracted/normalized library high. Moreover, our method dramatically enhances the discovery of new genes as compared to results obtained by using standard, full-length cDNA libraries. This procedure can be extended to the preparation of full-length cDNA encyclopedias from other organisms.
Quantitative trait locus (QTL) mapping was used to locate genes that determine the difference in cholesterol gallstone disease between the gallstone-susceptible strain C57L/J and the gallstone-resistant strain AKR/J. Gallstone weight was determined in 231 male (AKR x C57L) F(1) x AKR backcross mice fed a lithogenic diet containing 1% cholesterol, 0.5% cholic acid, and 15% butterfat for 8 wk. Mice having no stones and mice having the largest stones were genotyped at approximately 20-cM intervals to find the loci determining cholesterol gallstone formation. The major locus, Lith1, mapped near D2Mit56 and was confirmed by constructing a congenic strain, AK. L-Lith1(s). Another locus, Lith2, mapped near D19Mit58 and was also confirmed by constructing a congenic strain AK.L-Lith2(s). Other suggestive, but not statistically significant, loci mapped to chromosomes 6, 7, 8, 10, and X. The identification of these Lith genes will elucidate the pathophysiology of cholesterol gallstone formation.
The RIKEN high-throughput 384-format sequencing pipeline (RISA system) including a 384-multicapillary sequencer (the so-called RISA sequencer) was developed for the RIKEN mouse encyclopedia project. The RISA system consists of colony picking, template preparation, sequencing reaction, and the sequencing process. A novel high-throughput 384-format capillary sequencer system (RISA sequencer system) was developed for the sequencing process. This system consists of a 384-multicapillary auto sequencer (RISA sequencer), a 384-multicapillary array assembler (CAS), and a 384-multicapillary casting device. The RISA sequencer can simultaneously analyze 384 independent sequencing products. The optical system is a scanning system chosen after careful comparison with an image detection system for the simultaneous detection of the 384-capillary array. This scanning system can be used with any fluorescent-labeled sequencing reaction (chain termination reaction), including transcriptional sequencing based on RNA polymerase, which was originally developed by us, and cycle sequencing based on thermostable DNA polymerase. For long-read sequencing, 380 out of 384 sequences (99.2%) were successfully analyzed and the average read length, with more than 99% accuracy, was 654.4 bp. A single RISA sequencer can analyze 216 kb with >99% accuracy in 2.7 h (90 kb/h). For short-read sequencing to cluster the 3' end and 5' end sequencing by reading 350 bp, 384 samples can be analyzed in 1.5 h. We have also developed a RISA inoculator, RISA filtrator and densitometer, RISA plasmid preparator which can handle throughput of 40,000 samples in 17.5 h, and a high-throughput RISA thermal cycler which has four 384-well sites. The combination of these technologies allowed us to construct the RISA system consisting of 16 RISA sequencers, which can process 50,000 DNA samples per day. One haploid genome shotgun sequence of a higher organism, such as human, mouse, rat, domestic animals, and plants, can be revealed by seven RISA systems within one month.
The Lith1 region on Chromosome (Chr) 2 contains a gene that markedly affects the prevalence of cholesterol gallstones in inbred mice. We report the high-resolution genetic and radiation hybrid maps of the chromosomal region surrounding Lith1, using three resources: a DNA panel from 188 progeny from two reciprocal backcrosses between C57BL/6 and Mus spretus inbred strains; 423 progeny of an N4 generation from backcrossing the susceptible C57L/J alleles at Lith1 into the resistant AKR/J strain; and the newly developed hamster-mouse T31 radiation hybrid panel. We mapped 17 microsatellite markers in the D2Mit182 to D2Mit14 region and two candidate genes for Lith1, the canalicular bile salt export pump (Bsep) also known as sister of P-glycoprotein (Spgp) and the low-density-lipoprotein-receptor-related gene megalin (Gp330). Both genetic maps were in agreement and ordered the microsatellite markers into a 10.4 +/- 1.5 cM region. The high-resolution physical map revealed ordering of microsatellite markers and relative distances between markers in almost complete agreement with the genetic maps. Mapping of Bsep revealed its location on Chr 2, homologous to the human chromosomal position (Nature Genet 20, 233-238, 1998). The radiation hybrid results also provided the highest resolution of the area containing the two candidate genes, which both mapped in the Lith1 region with close linkage, being separated by a distance of only 15 cR(3000). The total radiation hybrid map length of the region between D2Mit182 and D2Mit14 was 326 cR(3000), suggesting that 31 cR(3000) is equivalent to 1 cM in this region of Chr 2.