Abca7 | GeneID:27403 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 27403 Official Symbol Abca7
Locus N/A Gene Type protein-coding
Synonyms ABCX; Abc51
Full Name ATP-binding cassette, sub-family A (ABC1), member 7
Description ATP-binding cassette, sub-family A (ABC1), member 7
Chromosome 10 B4-C1|10 44.0 cM
Also Known As ATP-binding cassette, sub-family A, member 7
Summary The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein is widely expressed with highest detection in spleen and hematopoietic tissues. The function of this protein has not yet been determined; however, a related human protein is thought to play a role in lipid homeostasis in cells of the immune system. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 22783

ID Symbol Protein Species
GeneID:10347 ABCA7 NP_061985.2 Homo sapiens
GeneID:27403 Abca7 NP_038878.1 Mus musculus
GeneID:299609 Abca7 NP_997481.1 Rattus norvegicus
GeneID:455538 ABCA7 XP_512226.2 Pan troglodytes
GeneID:485090 ABCA7 XP_542208.2 Canis lupus familiaris
GeneID:511762 ABCA7 XP_589159.3 Bos taurus

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab48265 ABCA7 antibody [7A1-144] (ab48265); Rat monoclonal [7A1-144] to ABCA7
2 acris AM05636PU-N ABCA7; antibody Ab

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016324 Component apical plasma membrane
GO:0005768 Component endosome
GO:0005794 Component Golgi apparatus
GO:0016021 Component integral to membrane
GO:0005622 Component intracellular
GO:0016020 Component membrane
GO:0005886 Component plasma membrane
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0017111 Function nucleoside-triphosphatase activity
GO:0000166 Function nucleotide binding
GO:0005548 Function phospholipid transporter activity
GO:0006909 Process phagocytosis
GO:0033700 Process phospholipid efflux
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_013850  UCSC Browser NP_038878

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000043866 MI0003140 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENSMUST00000043866 MI0003141 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENSMUST00000043866 MI0003171 hsa-miR-518d-5p CUCUAGAGGGAAGCACUUUCUG
ENSMUST00000043866 MI0003149 hsa-miR-520a-5p CUCCAGAGGGAAGUACUUUCU
ENSMUST00000043866 MI0003152 hsa-miR-525-5p CUCCAGAGGGAUGCACUUUCU
ENSMUST00000043866 MI0003559 hsa-miR-554 GCUAGUCCUGACUCAGCCAGU
ENSMUST00000043866 MI0005762 hsa-miR-940 AAGGCAGGGCCCCCGCUCCCC
ENSMUST00000043866 MI0000154 mmu-miR-127 UCGGAUCCGUCUGAGCUUGGCU
ENSMUST00000043866 MI0000172 mmu-miR-150* CUGGUACAGGCCUGGGGGAUAG
ENSMUST00000043866 MI0000244 mmu-miR-201 UACUCAGUAAGGCAUUGUUCUU
ENSMUST00000043866 MI0000143 mmu-miR-29b* GCUGGUUUCAUAUGGUGGUUUA
ENSMUST00000043866 MI0001653 mmu-miR-450a-5p UUUUGCGAUGUGUUCCUAAUAU
ENSMUST00000043866 MI0003537 mmu-miR-450a-5p UUUUGCGAUGUGUUCCUAAUAU
ENSMUST00000043866 MI0003534 mmu-miR-487b AAUCGUACAGGGUCAUCCACUU
ENSMUST00000043866 MI0004703 mmu-miR-501-5p AAUCCUUUGUCCCUGGGUGAAA
ENSMUST00000043866 MI0003206 mmu-miR-532-3p CCUCCCACACCCAAGGCUUGCA
ENSMUST00000043866 MI0005004 mmu-miR-615-3p UCCGAGCCUGGGUCUCCCUCUU
ENSMUST00000043866 MI0004134 mmu-miR-668 UGUCACUCGGCUCGGCCCACUACC
ENSMUST00000043866 MI0004682 mmu-miR-698 CAUUCUCGUUUCCUUCCCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Morales CR, et al. (2008) "ATP-binding cassette transporters ABCA1, ABCA7, and ABCG1 in mouse spermatozoa." Biochem Biophys Res Commun. 376(3):472-477. PMID:18793613
  2. [ + ] Jehle AW, et al. (2006) "ATP-binding cassette transporter A7 enhances phagocytosis of apoptotic cells and associated ERK signaling in macrophages." J Cell Biol. 174(4):547-556. PMID:16908670
  3. [ + ] Linsel-Nitschke P, et al. (2005) "Potential role of ABCA7 in cellular lipid efflux to apoA-I." J Lipid Res. 46(1):86-92. PMID:15520449
  4. [ + ] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072
  5. [ + ] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073
  6. [ + ] Wakaumi M, et al. (2005) "Acute digoxin loading reduces ABCA8A mRNA expression in the mouse liver." Clin Exp Pharmacol Physiol. 32(12):1034-1041. PMID:16445568
  7. [ + ] Kim WS, et al. (2005) "Abca7 null mice retain normal macrophage phosphatidylcholine and cholesterol efflux activity despite alterations in adipose mass and serum cholesterol levels." J Biol Chem. 280(5):3989-3995. PMID:15550377
  8. [ + ] Watahiki A, et al. (2004) "Libraries enriched for alternatively spliced exons reveal splicing patterns in melanocytes and melanomas." Nat Methods. 1(3):233-239. PMID:15782199
  9. [ + ] Wang N, et al. (2003) "ATP-binding cassette transporter A7 (ABCA7) binds apolipoprotein A-I and mediates cellular phospholipid but not cholesterol efflux." J Biol Chem. 278(44):42906-42912. PMID:12917409
  10. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  11. [ + ] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851
  12. [ + ] Honarpour N, et al. (2001) "Apaf-1 deficiency and neural tube closure defects are found in fog mice." Proc Natl Acad Sci U S A. 98(17):9683-9687. PMID:11504943
  13. [ + ] Broccardo C, et al. (2001) "Comparative analysis of the promoter structure and genomic organization of the human and mouse ABCA7 gene encoding a novel ABCA transporter." Cytogenet Cell Genet. 92(3-4):264-270. PMID:11435699
  14. [ + ] Kawai J, et al. (2001) "Functional annotation of a full-length mouse cDNA collection." Nature. 409(6821):685-690. PMID:11217851
  15. [ + ] Schriml LM, et al. (2000) "Use of denaturing HPLC to map human and murine genes and to validate single-nucleotide polymorphisms." Biotechniques. 28(4):740-745. PMID:10769753
  16. [ + ] Schriml LM, et al. (2000) "Identification of 18 mouse ABC genes and characterization of the ABC superfamily in Mus musculus." Genomics. 64(1):24-31. PMID:10708515
  17. [ + ] Shibata K, et al. (2000) "RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer." Genome Res. 10(11):1757-1771. PMID:11076861
  18. [ + ] Carninci P, et al. (2000) "Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes." Genome Res. 10(10):1617-1630. PMID:11042159
  19. [ + ] Carninci P, et al. (1999) "High-efficiency full-length cDNA cloning." Methods Enzymol. 303():19-44. PMID:10349636