Abca7 | GeneID:27403 | Mus musculus
Gene Summary
[
] NCBI Entrez Gene
| Gene ID | 27403 | Official Symbol | Abca7 |
|---|---|---|---|
| Locus | N/A | Gene Type | protein-coding |
| Synonyms | ABCX; Abc51 | ||
| Full Name | ATP-binding cassette, sub-family A (ABC1), member 7 | ||
| Description | ATP-binding cassette, sub-family A (ABC1), member 7 | ||
| Chromosome | 10 B4-C1|10 44.0 cM | ||
| Also Known As | ATP-binding cassette, sub-family A, member 7 | ||
| Summary | The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein is widely expressed with highest detection in spleen and hematopoietic tissues. The function of this protein has not yet been determined; however, a related human protein is thought to play a role in lipid homeostasis in cells of the immune system. [provided by RefSeq] | ||
Orthologs and Paralogs
[
] Homologs - NCBI's HomoloGene Group: 22783
| ID | Symbol | Protein | Species |
|---|---|---|---|
| GeneID:10347 | ABCA7 | NP_061985.2 | Homo sapiens |
| GeneID:27403 | Abca7 | NP_038878.1 | Mus musculus |
| GeneID:299609 | Abca7 | NP_997481.1 | Rattus norvegicus |
| GeneID:455538 | ABCA7 | XP_512226.2 | Pan troglodytes |
| GeneID:485090 | ABCA7 | XP_542208.2 | Canis lupus familiaris |
| GeneID:511762 | ABCA7 | XP_589159.3 | Bos taurus |
Antibodies
[
] Monoclonal and Polyclonal Antibodies
| No. | Provider | Product No. | Description |
|---|---|---|---|
| 1 | abcam | ab48265 | ABCA7 antibody [7A1-144] (ab48265); Rat monoclonal [7A1-144] to ABCA7 |
| 2 | acris | AM05636PU-N | ABCA7; antibody Ab |
Gene Classification
[
] Gene Ontology
| ID | Category | GO Term |
|---|---|---|
| GO:0016324 | Component | apical plasma membrane |
| GO:0005768 | Component | endosome |
| GO:0005794 | Component | Golgi apparatus |
| GO:0016021 | Component | integral to membrane |
| GO:0005622 | Component | intracellular |
| GO:0016020 | Component | membrane |
| GO:0005886 | Component | plasma membrane |
| GO:0016887 | Function | ATPase activity |
| GO:0005524 | Function | ATP binding |
| GO:0017111 | Function | nucleoside-triphosphatase activity |
| GO:0000166 | Function | nucleotide binding |
| GO:0005548 | Function | phospholipid transporter activity |
| GO:0006909 | Process | phagocytosis |
| GO:0033700 | Process | phospholipid efflux |
| GO:0006810 | Process | transport |
MicroRNA and Targets
[
] MicroRNA Sequences and Transcript Targets from miRBase at Sanger
| RNA Target | miRNA # | mat miRNA | Mature miRNA Sequence |
|---|---|---|---|
| ENSMUST00000043866 | MI0003140 | hsa-miR-512-5p | CACUCAGCCUUGAGGGCACUUUC |
| ENSMUST00000043866 | MI0003141 | hsa-miR-512-5p | CACUCAGCCUUGAGGGCACUUUC |
| ENSMUST00000043866 | MI0003171 | hsa-miR-518d-5p | CUCUAGAGGGAAGCACUUUCUG |
| ENSMUST00000043866 | MI0003149 | hsa-miR-520a-5p | CUCCAGAGGGAAGUACUUUCU |
| ENSMUST00000043866 | MI0003152 | hsa-miR-525-5p | CUCCAGAGGGAUGCACUUUCU |
| ENSMUST00000043866 | MI0003559 | hsa-miR-554 | GCUAGUCCUGACUCAGCCAGU |
| ENSMUST00000043866 | MI0005762 | hsa-miR-940 | AAGGCAGGGCCCCCGCUCCCC |
| ENSMUST00000043866 | MI0000154 | mmu-miR-127 | UCGGAUCCGUCUGAGCUUGGCU |
| ENSMUST00000043866 | MI0000172 | mmu-miR-150* | CUGGUACAGGCCUGGGGGAUAG |
| ENSMUST00000043866 | MI0000244 | mmu-miR-201 | UACUCAGUAAGGCAUUGUUCUU |
| ENSMUST00000043866 | MI0000143 | mmu-miR-29b* | GCUGGUUUCAUAUGGUGGUUUA |
| ENSMUST00000043866 | MI0001653 | mmu-miR-450a-5p | UUUUGCGAUGUGUUCCUAAUAU |
| ENSMUST00000043866 | MI0003537 | mmu-miR-450a-5p | UUUUGCGAUGUGUUCCUAAUAU |
| ENSMUST00000043866 | MI0003534 | mmu-miR-487b | AAUCGUACAGGGUCAUCCACUU |
| ENSMUST00000043866 | MI0004703 | mmu-miR-501-5p | AAUCCUUUGUCCCUGGGUGAAA |
| ENSMUST00000043866 | MI0003206 | mmu-miR-532-3p | CCUCCCACACCCAAGGCUUGCA |
| ENSMUST00000043866 | MI0005004 | mmu-miR-615-3p | UCCGAGCCUGGGUCUCCCUCUU |
| ENSMUST00000043866 | MI0004134 | mmu-miR-668 | UGUCACUCGGCUCGGCCCACUACC |
| ENSMUST00000043866 | MI0004682 | mmu-miR-698 | CAUUCUCGUUUCCUUCCCU |
Selected Publications
[
] Gene-related publications indexed at PubMed
- [
] Morales CR, et al. (2008) "ATP-binding cassette transporters ABCA1, ABCA7, and ABCG1 in mouse spermatozoa." Biochem Biophys Res Commun. 376(3):472-477. PMID:18793613 - [
] Jehle AW, et al. (2006) "ATP-binding cassette transporter A7 enhances phagocytosis of apoptotic cells and associated ERK signaling in macrophages." J Cell Biol. 174(4):547-556. PMID:16908670 - [
] Linsel-Nitschke P, et al. (2005) "Potential role of ABCA7 in cellular lipid efflux to apoA-I." J Lipid Res. 46(1):86-92. PMID:15520449 - [
] Kim WS, et al. (2005) "Abca7 null mice retain normal macrophage phosphatidylcholine and cholesterol efflux activity despite alterations in adipose mass and serum cholesterol levels." J Biol Chem. 280(5):3989-3995. PMID:15550377 - [
] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072 - [
] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073 - [
] Wakaumi M, et al. (2005) "Acute digoxin loading reduces ABCA8A mRNA expression in the mouse liver." Clin Exp Pharmacol Physiol. 32(12):1034-1041. PMID:16445568 - [
] Watahiki A, et al. (2004) "Libraries enriched for alternatively spliced exons reveal splicing patterns in melanocytes and melanomas." Nat Methods. 1(3):233-239. PMID:15782199 - [
] Wang N, et al. (2003) "ATP-binding cassette transporter A7 (ABCA7) binds apolipoprotein A-I and mediates cellular phospholipid but not cholesterol efflux." J Biol Chem. 278(44):42906-42912. PMID:12917409 - [
] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851 - [
] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932 - [
] Kawai J, et al. (2001) "Functional annotation of a full-length mouse cDNA collection." Nature. 409(6821):685-690. PMID:11217851 - [
] Broccardo C, et al. (2001) "Comparative analysis of the promoter structure and genomic organization of the human and mouse ABCA7 gene encoding a novel ABCA transporter." Cytogenet Cell Genet. 92(3-4):264-270. PMID:11435699 - [
] Honarpour N, et al. (2001) "Apaf-1 deficiency and neural tube closure defects are found in fog mice." Proc Natl Acad Sci U S A. 98(17):9683-9687. PMID:11504943 - [
] Schriml LM, et al. (2000) "Identification of 18 mouse ABC genes and characterization of the ABC superfamily in Mus musculus." Genomics. 64(1):24-31. PMID:10708515 - [
] Schriml LM, et al. (2000) "Use of denaturing HPLC to map human and murine genes and to validate single-nucleotide polymorphisms." Biotechniques. 28(4):740-745. PMID:10769753 - [
] Carninci P, et al. (2000) "Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes." Genome Res. 10(10):1617-1630. PMID:11042159 - [
] Shibata K, et al. (2000) "RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer." Genome Res. 10(11):1757-1771. PMID:11076861 - [
] Carninci P, et al. (1999) "High-efficiency full-length cDNA cloning." Methods Enzymol. 303():19-44. PMID:10349636
Mammalian spermatozoa lose plasma membrane cholesterol during their maturation in the epididymis and during their capacitation in the female reproductive tract. While acceptors such as high-density lipoproteins (HDL) and apolipoproteins A-I (apoA-I) and J have been found in male and female reproductive tracts, transporters that mediate cholesterol efflux from plasma membranes of spermatozoa to such acceptors have not yet been defined. Candidate transporters are members of the ATP-binding cassette (ABC) transporter superfamily including ABCA1, ABCA7, ABCG1 and ABCG4, which have all been implicated in the transport of sterols and phospholipids to apolipoproteins and HDL. Here we show that mouse spermatozoa in the seminiferous tubules and epididymis express ABCA1, ABCA7 and ABCG1, but not ABCG4. Moreover, we show that ABCA1, ABCA7, and ABCG1 antibodies decrease cholesterol efflux from spermatozoa to lipid acceptors apoA-I and albumin and inhibit in vitro fertilization.
The mammalian ATP-binding cassette transporters A1 and A7 (ABCA1 and -A7) show sequence similarity to CED-7, a Caenorhabditis elegans gene that mediates the clearance of apoptotic cells. Using RNA interference or gene targeting, we show that knock down of macrophage ABCA7 but not -A1 results in defective engulfment of apoptotic cells. In response to apoptotic cells, ABCA7 moves to the macrophage cell surface and colocalizes with the low-density lipoprotein receptor-related protein 1 (LRP1) in phagocytic cups. The cell surface localization of ABCA7 and LRP1 is defective in ABCA7-deficient cells. C1q is an opsonin of apoptotic cells that acts via phagocyte LRP1 to induce extracellular signal-regulated kinase (ERK) signaling. We show that ERK signaling is required for phagocytosis of apoptotic cells and that ERK phosphorylation in response to apoptotic cells or C1q is defective in ABCA7-deficient cells. These studies reveal a major role of ABCA7 and not -A1 in the clearance of apoptotic cells and therefore suggest that ABCA7 is an authentic orthologue of CED-7.
ABCA7 is homologous to ABCA1 and has recently been shown in cell culture to bind apolipoprotein A-I (apoA-I) and to promote the efflux of phospholipids. However, it is not known if ABCA7 promotes lipid efflux in vivo. When expressed in HEK293 cells, both human and mouse ABCA7 promoted phospholipid efflux to apoA-I but no detectable cholesterol efflux. However, genetic knockdown of ABCA7 in mouse peritoneal macrophages did not affect phospholipid or cholesterol efflux to apoA-I. Moreover, in ABCA1-knockout macrophages, there was no detectable apoA-I-stimulated phospholipid efflux, inconsistent with a residual role of ABCA7. In contrast to plasma membrane localization of ABCA7 in transfected embryonic kidney cells, immunofluorescence microscopy of endogenous ABCA7 in macrophages showed a predominantly intracellular localization of the protein. Strikingly, immunofluorescence studies of adult mouse kidney revealed an apical brush border membrane localization of ABCA7 in the proximal tubule, suggesting that ABCA7 may come in contact with apoA-I in the glomerular filtrate. Although ABCA7 does not contribute to apolipoprotein-mediated lipid efflux in resting macrophages, its cell surface location in the kidney suggests that it could serve such a role in tissue microenvironments.
Mutations in the A class of ATP-binding cassette transporters (ABCA) are causally implicated in three human diseases: Tangier disease (ABCA1), Stargadt's macular degeneration (ABCA4), and neonatal respiratory failure (ABCA3). Both ABCA1 and ABCA4 have been shown to transport lipids across cellular membranes, and ABCA3 may play a similar role in transporting pulmonary surfactant. Although the functions of the other 10 ABCA class transporters identified in the human genome remain obscure, ABCA7-transfected cells have been shown to efflux lipids in response to stimulation by apolipoprotein A-I. In an effort to elucidate the physiologic role of ABCA7, we generated mice lacking this transporter (Abca7-/- mice). Homozygous null mice were produced from intercrosses of heterozygous null mice at the expected Mendelian frequency and developed normally without any obvious phenotypic abnormalities. Cholesterol and phospholipid efflux stimulated by apolipoprotein A-I from macrophages isolated from wild type and Abca7-/- mice did not differ, suggesting that these activities may not be central to the physiological role of the transporter in vivo. Abca7-/- females, but not males, had significantly less visceral fat and lower total serum and high density lipoprotein cholesterol levels than wild type, gender-matched littermates. ABCA7 expression was detected in hippocampal and cortical neurons by in situ hybridization and in brain and white adipose tissue by Western blotting. Induction of adipocyte differentiation from 3T3 fibroblasts in culture led to a marked increase in ABCA7 expression. These studies suggest that ABCA7 plays a novel role in lipid and fat metabolism that Abca7-/- mice can be used to elucidate.
This study describes comprehensive polling of transcription start and termination sites and analysis of previously unidentified full-length complementary DNAs derived from the mouse genome. We identify the 5' and 3' boundaries of 181,047 transcripts with extensive variation in transcripts arising from alternative promoter usage, splicing, and polyadenylation. There are 16,247 new mouse protein-coding transcripts, including 5154 encoding previously unidentified proteins. Genomic mapping of the transcriptome reveals transcriptional forests, with overlapping transcription on both strands, separated by deserts in which few transcripts are observed. The data provide a comprehensive platform for the comparative analysis of mammalian transcriptional regulation in differentiation and development.
Antisense transcription (transcription from the opposite strand to a protein-coding or sense strand) has been ascribed roles in gene regulation involving degradation of the corresponding sense transcripts (RNA interference), as well as gene silencing at the chromatin level. Global transcriptome analysis provides evidence that a large proportion of the genome can produce transcripts from both strands, and that antisense transcripts commonly link neighboring "genes" in complex loci into chains of linked transcriptional units. Expression profiling reveals frequent concordant regulation of sense/antisense pairs. We present experimental evidence that perturbation of an antisense RNA can alter the expression of sense messenger RNAs, suggesting that antisense transcription contributes to control of transcriptional outputs in mammals.
Human ABCA8, a new member of the ATP binding cassette (ABC) transporter family, transports certain lipophilic drugs, such as digoxin. To investigate the roles of this transporter, we cloned a mouse homologue of ABCA8, from a mouse heart cDNA library, named ABCA8a. The deduced mouse ABCA8a protein is 66% identical with that of human ABCA8 and possesses features common to the ABC superfamily. It was found that ABCA8a was mainly expressed in the liver and heart, similar to human ABCA8. We further evaluated the effect of acute digoxin (a substrate for ABCA8) intoxication on the mRNA expression of ABCA8 using northern blotting with a 3' non-coding region as a probe to avoid cross-hybridization with other ABCA genes. Following acute digoxin infusion, the mRNA expression of ABCA8 was significantly reduced in the liver 12-24 h after injection (14.7% of vehicle treatment), but not in the heart and kidney. Real-time quantitative polymerase chain reaction analysis confirmed the reduction in ABCA8a mRNA. Similar reductions in ABCA5, ABCA7, ABCA8b and ABCA9 mRNA were also observed. A comparable amount of digitoxin did not affect ABCA8a mRNA expression in the liver. The results suggest that ABCA8 may play a role in digoxin metabolism in the liver.
It is becoming increasingly clear that alternative splicing enables the complex development and homeostasis of higher organisms. To gain a better understanding of how splicing contributes to regulatory pathways, we have developed an alternative splicing library approach for the identification of alternatively spliced exons and their flanking regions by alternative splicing sequence enriched tags sequencing. Here, we have applied our approach to mouse melan-c melanocyte and B16-F10Y melanoma cell lines, in which 5,401 genes were found to be alternatively spliced. These genes include those encoding important regulatory factors such as cyclin D2, Ilk, MAPK12, MAPK14, RAB4, melastatin 1 and previously unidentified splicing events for 436 genes. Real-time PCR further identified cell line-specific exons for Tmc6, Abi1, Sorbs1, Ndel1 and Snx16. Thus, the ASL approach proved effective in identifying splicing events, which suggest that alternative splicing is important in melanoma development.
ATP-binding cassette transporter 1 (ABCA1), the defective transporter in Tangier disease, binds and promotes cellular cholesterol and phospholipid efflux to apolipoprotein I (apoA-I). Based on a high degree of sequence homology between ABCA1 and ABCA7, a transporter of unknown function, we investigated the possibility that ABCA7 might be involved in apolipoprotein binding and lipid efflux. Similarly to cells expressing ABCA1, HEK293 cells overexpressing ABCA7 showed specific binding and cross-linking of lipid-poor apoA-I. ABCA7 expression increased cellular phosphatidylcholine and sphingomyelin efflux to apoA-I in a manner similar to ABCA1 but had no effect on cholesterol efflux. Western analysis showed a high protein level of ABCA7 in mouse spleen, lung, adrenal, and brain but low expression in liver. In contrast to ABCA1, ABCA7 showed moderate basal mRNA and protein levels in macrophages and lymphocytes but no induction by liver X receptor activation. These studies show that ABCA7 has the ability to bind apolipoproteins and promote efflux of cellular phospholipids without cholesterol, and they suggest a possible role of ABCA7 in cellular phospholipid metabolism in peripheral tissues.
Only a small proportion of the mouse genome is transcribed into mature messenger RNA transcripts. There is an international collaborative effort to identify all full-length mRNA transcripts from the mouse, and to ensure that each is represented in a physical collection of clones. Here we report the manual annotation of 60,770 full-length mouse complementary DNA sequences. These are clustered into 33,409 'transcriptional units', contributing 90.1% of a newly established mouse transcriptome database. Of these transcriptional units, 4,258 are new protein-coding and 11,665 are new non-coding messages, indicating that non-coding RNA is a major component of the transcriptome. 41% of all transcriptional units showed evidence of alternative splicing. In protein-coding transcripts, 79% of splice variations altered the protein product. Whole-transcriptome analyses resulted in the identification of 2,431 sense-antisense pairs. The present work, completely supported by physical clones, provides the most comprehensive survey of a mammalian transcriptome so far, and is a valuable resource for functional genomics.
The National Institutes of Health Mammalian Gene Collection (MGC) Program is a multiinstitutional effort to identify and sequence a cDNA clone containing a complete ORF for each human and mouse gene. ESTs were generated from libraries enriched for full-length cDNAs and analyzed to identify candidate full-ORF clones, which then were sequenced to high accuracy. The MGC has currently sequenced and verified the full ORF for a nonredundant set of >9,000 human and >6,000 mouse genes. Candidate full-ORF clones for an additional 7,800 human and 3,500 mouse genes also have been identified. All MGC sequences and clones are available without restriction through public databases and clone distribution networks (see http:mgc.nci.nih.gov).
The RIKEN Mouse Gene Encyclopaedia Project, a systematic approach to determining the full coding potential of the mouse genome, involves collection and sequencing of full-length complementary DNAs and physical mapping of the corresponding genes to the mouse genome. We organized an international functional annotation meeting (FANTOM) to annotate the first 21,076 cDNAs to be analysed in this project. Here we describe the first RIKEN clone collection, which is one of the largest described for any organism. Analysis of these cDNAs extends known gene families and identifies new ones.
We report here the genomic and transcriptional characterization in mouse and man of a novel transporter of the ABCA subclass, named ABCA7. As it is the case for other ABCA genes, the predicted protein encoded by ABCA7 is a full symmetric transporter, highly conserved across species. The ABCA7 gene maps to human chromosome 19 and to the homologous region at band B4-C1 on mouse chromosome 10. The preferential expression of ABCA7 in the spleen, thymus, and fetal liver is consistent with the finding, in both human and mouse promoter, of sites targeted by lymphomyeloid-specific transcription factors. This suggests that ABCA7 may play a pivotal role in the developmental specification of hematopoietic cell lineages.
The forebrain overgrowth mutation (fog) was originally described as a spontaneous autosomal recessive mutation mapping to mouse chromosome 10 that produces forebrain defects, facial defects, and spina bifida. Although the fog mutant has been characterized and available to investigators for several years, the underlying mutation causing the pathology has not been known. Because of its phenotypic resemblance to apoptotic protease activating factor-1 (Apaf-1) knockout mice, we have investigated the possibility that the fog mutation is in the Apaf-1 gene. Allelic complementation, Western blot analysis, and caspase activation assays indicate that fog mutant mice lack Apaf-1 activity. Northern blot and reverse transcription-PCR analysis show that Apaf-1 mRNA is aberrantly processed, resulting in greatly reduced expression levels of normal Apaf-1 mRNA. These findings are strongly suggestive of the fog mutation being a hypomorphic Apaf-1 defect and implicate neural progenitor cell death in the pathogenesis of spina bifida-a common human congenital malformation. Because a complete deficiency in Apaf-1 usually results in perinatal lethality and fog/fog mice more readily survive into adulthood, these mutants serve as a valuable model with which apoptotic cell death can be studied in vivo.
ATP-binding cassette (ABC) genes encode a family of transport proteins known to be involved in a number of human genetic diseases. In this study, we characterized the ABC superfamily in Mus musculus through in silico gene identification and mapping and phylogenetic analysis of mouse and human ABC genes. By querying dbEST with amino acid sequences from the conserved ATP-binding domains, we identified and partially sequenced 18 new mouse ABC genes, bringing the total number of mouse ABC genes to 34. Twelve of the new ABC genes were mapped in the mouse genome to the X chromosome and to 10 of the 19 autosomes. Phylogenetic relationships of mouse and human ABC genes were examined with maximum parsimony and neighbor-joining analyses that demonstrated that mouse and human ABC orthologs are more closely related than are mouse paralogs. The mouse ABC genes could be grouped into the seven previously described human ABC subfamilies. Three mouse ABC genes mapped to regions implicated in cholesterol gallstone susceptibility.
Linkage mapping has been extensively applied in the murine and human genomes. It remains a powerful approach to mapping genes and identifying genetic variants. As genome efforts identify large numbers of single-nucleotide polymorphisms, it will be critical to validate these polymorphisms and confirm their gene assignment and chromosomal location. The presence of pseudogenes can confuse such efforts. We have used denaturing HPLC to identify polymorphisms in human genes and to genotype individuals in selected CEPH pedigrees. The same approach has been applied to the mapping of murine genes in interspecies backcross animals. This strategy is rapid, accurate and superior in several respects to other technologies.
In the effort to prepare the mouse full-length cDNA encyclopedia, we previously developed several techniques to prepare and select full-length cDNAs. To increase the number of different cDNAs, we introduce here a strategy to prepare normalized and subtracted cDNA libraries in a single step. The method is based on hybridization of the first-strand, full-length cDNA with several RNA drivers, including starting mRNA as the normalizing driver and run-off transcripts from minilibraries containing highly expressed genes, rearrayed clones, and previously sequenced cDNAs as subtracting drivers. Our method keeps the proportion of full-length cDNAs in the subtracted/normalized library high. Moreover, our method dramatically enhances the discovery of new genes as compared to results obtained by using standard, full-length cDNA libraries. This procedure can be extended to the preparation of full-length cDNA encyclopedias from other organisms.
The RIKEN high-throughput 384-format sequencing pipeline (RISA system) including a 384-multicapillary sequencer (the so-called RISA sequencer) was developed for the RIKEN mouse encyclopedia project. The RISA system consists of colony picking, template preparation, sequencing reaction, and the sequencing process. A novel high-throughput 384-format capillary sequencer system (RISA sequencer system) was developed for the sequencing process. This system consists of a 384-multicapillary auto sequencer (RISA sequencer), a 384-multicapillary array assembler (CAS), and a 384-multicapillary casting device. The RISA sequencer can simultaneously analyze 384 independent sequencing products. The optical system is a scanning system chosen after careful comparison with an image detection system for the simultaneous detection of the 384-capillary array. This scanning system can be used with any fluorescent-labeled sequencing reaction (chain termination reaction), including transcriptional sequencing based on RNA polymerase, which was originally developed by us, and cycle sequencing based on thermostable DNA polymerase. For long-read sequencing, 380 out of 384 sequences (99.2%) were successfully analyzed and the average read length, with more than 99% accuracy, was 654.4 bp. A single RISA sequencer can analyze 216 kb with >99% accuracy in 2.7 h (90 kb/h). For short-read sequencing to cluster the 3' end and 5' end sequencing by reading 350 bp, 384 samples can be analyzed in 1.5 h. We have also developed a RISA inoculator, RISA filtrator and densitometer, RISA plasmid preparator which can handle throughput of 40,000 samples in 17.5 h, and a high-throughput RISA thermal cycler which has four 384-well sites. The combination of these technologies allowed us to construct the RISA system consisting of 16 RISA sequencers, which can process 50,000 DNA samples per day. One haploid genome shotgun sequence of a higher organism, such as human, mouse, rat, domestic animals, and plants, can be revealed by seven RISA systems within one month.