ACAD8 | GeneID:27034 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 27034 Official Symbol ACAD8
Locus N/A Gene Type protein-coding
Synonyms ACAD-8; FLJ22590
Full Name acyl-Coenzyme A dehydrogenase family, member 8
Description acyl-Coenzyme A dehydrogenase family, member 8
Chromosome 11q25
Also Known As acyl-coenzyme A dehydrogenase 8
Summary Isobutyryl-CoA dehydrogenase (EC 1.3.99), encoded by the ACAD8 gene, catalyzes the third step of the degradation of the branched chain amino acid valine (Nguyen et al., 2002 [PubMed 12359132]).[supplied by OMIM]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 8662

ID Symbol Protein Species
GeneID:27034 ACAD8 NP_055199.1 Homo sapiens
GeneID:66948 Acad8 NP_080138.2 Mus musculus
GeneID:173466 F28A10.6 NP_493832.1 Caenorhabditis elegans
GeneID:394130 acad8 NP_957449.1 Danio rerio
GeneID:419739 ACAD8 XP_417879.2 Gallus gallus
GeneID:451683 ACAD8 XP_508872.2 Pan troglodytes
GeneID:479386 ACAD8 XP_536524.2 Canis lupus familiaris
GeneID:512070 ACAD8 NP_001069019.1 Bos taurus

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab37842 ACAD8 antibody (ab37842); Chicken polyclonal to ACAD8
2 abcam ab37843 ACAD8 antibody (ab37843); Chicken polyclonal to ACAD8
3 scbt ACAD8 ACAD8 Antibody / ACAD8 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ACAD8 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ACAD8 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005739 Component mitochondrion
GO:0003995 Function acyl-CoA dehydrogenase activity
GO:0009055 Function electron carrier activity
GO:0050660 Function FAD binding
GO:0009083 Process branched chain family amino acid catabolic process
GO:0006629 Process lipid metabolic process
GO:0055114 Process oxidation reduction
GO:0006355 Process regulation of transcription, DNA-dependent
GO:0006350 Process transcription

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_014384  UCSC Browser NP_055199

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000281182 MI0000457 hsa-miR-141 UAACACUGUCUGGUAAAGAUGG
ENST00000281182 MI0000461 hsa-miR-145 GUCCAGUUUUCCCAGGAAUCCCU
ENST00000281182 MI0000269 hsa-miR-181a-2* ACCACUGACCGUUGACUGUACC
ENST00000281182 MI0000273 hsa-miR-183 UAUGGCACUGGUAGAAUUCACU
ENST00000281182 MI0000072 hsa-miR-18a UAAGGUGCAUCUAGUGCAGAUAG
ENST00000281182 MI0001150 hsa-miR-196b UAGGUAGUUUCCUGUUGUUGGG
ENST00000281182 MI0000240 hsa-miR-198 GGUCCAGAGGGGAGAUAGGUUC
ENST00000281182 MI0000737 hsa-miR-200a UAACACUGUCUGGUAACGAUGU
ENST00000281182 MI0000806 hsa-miR-337-5p GAACGGCUUCAUACAGGAGUU
ENST00000281182 MI0000815 hsa-miR-339-5p UCCCUGUCCUCCAGGAGCUCACG
ENST00000281182 MI0001723 hsa-miR-433 AUCAUGAUGGGCUCCUCGGUGU
ENST00000281182 MI0003513 hsa-miR-455-3p GCAGUCCAUGGGCAUAUACAC
ENST00000281182 MI0002467 hsa-miR-483-3p UCACUCCUCUCCUCCCGUCUU
ENST00000281182 MI0005717 hsa-miR-509-3-5p UACUGCAGACGUGGCAAUCAUG
ENST00000281182 MI0003140 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENST00000281182 MI0003141 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENST00000281182 MI0003149 hsa-miR-520a-5p CUCCAGAGGGAAGUACUUUCU
ENST00000281182 MI0003515 hsa-miR-544 AUUCUGCAUUUUUAGCAAGUUC
ENST00000281182 MI0003591 hsa-miR-584 UUAUGGUUUGCCUGGGACUGAG
ENST00000281182 MI0003599 hsa-miR-589* UCAGAACAAAUGCCGGUUCCCAGA
ENST00000281182 MI0003615 hsa-miR-602 GACACGGGCGACAGCUGCGGCCC
ENST00000281182 MI0003638 hsa-miR-624 CACAAGGUAUUGGUAUUACCU
ENST00000281182 MI0003667 hsa-miR-652 AAUGGCGCCACUAGGGUUGUG
ENST00000281182 MI0003760 hsa-miR-671-3p UCCGGUUCUCAGGGCUCCACC
ENST00000281182 MI0005760 hsa-miR-938 UGCCCUUAAAGGUGAACCCAGU
ENST00000281182 MI0005768 hsa-miR-943 CUGACUGUUGCCGUCCUCCAG
ENST00000281182 MI0004644 mmu-miR-682 CUGCAGUCACAGUGAAGUCUG
ENST00000281182 MI0004690 mmu-miR-706 AGAGAAACCCUGUCUCAAAAAA
ENST00000281182 MI0005548 mmu-miR-878-5p UAUCUAGUUGGAUGUCAAGACA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen affects the expression of ACAD8 mRNA
17562736

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
ISOBUTYRYL-CoA DEHYDROGENASE DEFICIENCY marker
Hepatitis, Toxic inferred via Acetaminophen 2444490, 14986274, 17562736, 17522070, 16081117, 16177239, 15968718, 16227642
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Ma J, et al. (2007) "Identifying leukocyte gene expression patterns associated with plasma lipid levels in human subjects." Atherosclerosis. 191(1):63-72. PMID:16806233
  2. [ + ] Wollmer MA, et al. (2007) "Association study of cholesterol-related genes in Alzheimer's disease." Neurogenetics. 8(3):179-188. PMID:17387528
  3. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  4. [ + ] Battaile KP, et al. (2004) "Structures of isobutyryl-CoA dehydrogenase and enzyme-product complex: comparison with isovaleryl- and short-chain acyl-CoA dehydrogenases." J Biol Chem. 279(16):16526-16534. PMID:14752098
  5. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  6. [ + ] Nguyen TV, et al. (2002) "Identification of isobutyryl-CoA dehydrogenase and its deficiency in humans." Mol Genet Metab. 77(1-2):68-79. PMID:12359132
  7. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  8. [ + ] Andresen BS, et al. (2000) "Isolated 2-methylbutyrylglycinuria caused by short/branched-chain acyl-CoA dehydrogenase deficiency: identification of a new enzyme defect, resolution of its molecular basis, and evidence for distinct acyl-CoA dehydrogenases in isoleucine and valine metabolism." Am J Hum Genet. 67(5):1095-1103. PMID:11013134
  9. [ + ] Naar AM, et al. (1999) "Composite co-activator ARC mediates chromatin-directed transcriptional activation." Nature. 398(6730):828-832. PMID:10235267
  10. [ + ] Telford EA, et al. (1999) "Isolation and characterisation of a cDNA encoding the precursor for a novel member of the acyl-CoA dehydrogenase gene family." Biochim Biophys Acta. 1446(3):371-376. PMID:10524212