ABL2 | GeneID:27 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 27 Official Symbol ABL2
Locus RP11-177A2.3 Gene Type protein-coding
Synonyms ABLL; ARG; FLJ22224; FLJ31718; FLJ41441
Full Name v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene)
Description v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene)
Chromosome 1q24-q25
Also Known As Abelson murine leukemia viral (v-abl) oncogene homolog 2; Abelson-related; OTTHUMP00000033139; arg tyrosine kinase
Summary This gene encodes a member of the Abelson family of nonreceptor tyrosine protein kinase. The protein is highly similar to the ABL1 protein, including the tyrosine kinase, SH2 and SH3 domains, and has a role in cytoskeletal rearrangements by its C-terminal F-actin- and microtubule-binding sequences. This gene is expressed in both normal and tumor cells, and is involved in translocation with the ETV6 gene in leukemia. Multiple alternatively spliced transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 5278

ID Symbol Protein Species
GeneID:27 ABL2 NP_009298.1 Homo sapiens
GeneID:11352 Abl2 NP_033725.2 Mus musculus
GeneID:304883 Abl2 XP_222768.4 Rattus norvegicus
GeneID:395410 ABL2 XP_422269.2 Gallus gallus
GeneID:457552 ABL2 XP_001156169.1 Pan troglodytes
GeneID:480052 ABL2 XP_860695.1 Canis lupus familiaris
GeneID:511845 ABL2 XP_001253285.1 Bos taurus
GeneID:570636 abl2 XP_001923500.1 Danio rerio

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab54696 ABL2 antibody (ab54696); Mouse monoclonal to ABL2
2 abcam ab54695 ABL2 antibody (ab54695); Mouse monoclonal to ABL2
3 abcam ab54209 ABL2 antibody [1H1B11] (ab54209); Mouse monoclonal [1H1B11] to ABL2
4 abgent AP7695a ABL2 Antibody (N-term); Purified Rabbit Polyclonal Antibody (Pab)
5 abgent AP3018d ABL Antibody (Y251); Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
6 abgent AP3011a Phospho-ABL1-Y134 Antibody; Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
7 abgent AP3018a Phospho-ABL2 Antibody (Center); Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
8 abgent AP3018b ABL Antibody (R432); Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
9 abnova H00000027-M03 ABL2 monoclonal antibody (M03), clone 6D5; Mouse monoclonal antibody raised against a partial recombinant ABL2.
10 abnova H00000027-M09 ABL2 monoclonal antibody (M09), clone 5C6; Mouse monoclonal antibody raised against a partial recombinant ABL2.
11 abnova H00000027-M10 ABL2 monoclonal antibody (M10), clone 3E4; Mouse monoclonal antibody raised against a partial recombinant ABL2.
12 abnova H00000027-M04 ABL2 monoclonal antibody (M04), clone 3G3; Mouse monoclonal antibody raised against a partial recombinant ABL2.
13 abnova H00000027-M06 ABL2 monoclonal antibody (M06), clone 2H8; Mouse monoclonal antibody raised against a partial recombinant ABL2.
14 abnova H00000027-M08 ABL2 monoclonal antibody (M08), clone 5C7; Mouse monoclonal antibody raised against a partial recombinant ABL2.
15 abnova H00000027-M05 ABL2 monoclonal antibody (M05), clone 3D2; Mouse monoclonal antibody raised against a partial recombinant ABL2.
16 acris AP12555PU-N ABL2 (Center); antibody Ab
17 acris AP14453PU-N ABL2 (N-term); antibody Ab
18 acris AP12556PU-N ABL2 Y251; antibody Ab
19 scbt ABL2 ABL2 Antibody / ABL2 Antibodies;
20 sigma HPA001866 Anti-ABL2 antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABL2 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABL2 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005856 Component cytoskeleton
GO:0005524 Function ATP binding
GO:0000287 Function magnesium ion binding
GO:0030145 Function manganese ion binding
GO:0004715 Function non-membrane spanning protein tyrosine kinase activity
GO:0000166 Function nucleotide binding
GO:0005515 Function protein binding
GO:0016740 Function transferase activity
GO:0007155 Process cell adhesion
GO:0018108 Process peptidyl-tyrosine phosphorylation
GO:0051353 Process positive regulation of oxidoreductase activity
GO:0006464 Process protein modification process
GO:0007165 Process signal transduction

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001100108  UCSC Browser NP_001093578
2 NM_001136000  UCSC Browser NP_001129472
3 NM_001136001  UCSC Browser NP_001129473
4 NM_005158  UCSC Browser NP_005149
5 NM_007314  UCSC Browser NP_009298 P42684   A0M8X0  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000367623 MI0004998 gga-miR-460 CCUGCAUUGUACACACUGUGUG
ENST00000367623 MI0000284 hsa-miR-204 UUCCCUUUGUCAUCCUAUGCCU
ENST00000367623 MI0000286 hsa-miR-210 CUGUGCGUGUGACAGCGGCUGA
ENST00000367623 MI0000287 hsa-miR-211 UUCCCUUUGUCAUCCUUCGCCU
ENST00000367623 MI0000816 hsa-miR-335 UCAAGAGCAAUAACGAAAAAUGU
ENST00000367623 MI0001448 hsa-miR-425* AUCGGGAAUGUCGUGUCCGCCC
ENST00000367623 MI0003167 hsa-miR-516b AUCUGGAGGUAAGAAGCACUUU
ENST00000367623 MI0003172 hsa-miR-516b AUCUGGAGGUAAGAAGCACUUU
ENST00000367623 MI0003565 hsa-miR-559 UAAAGUAAAUAUGCACCAAAA
ENST00000367623 MI0003577 hsa-miR-570 CGAAAACAGCAAUUACCUUUGC
ENST00000367623 MI0003615 hsa-miR-602 GACACGGGCGACAGCUGCGGCCC
ENST00000367623 MI0003626 hsa-miR-613 AGGAAUGUUCCUUCUUUGCC
ENST00000367623 MI0003635 hsa-miR-621 GGCUAGCAACAGCGCUUACCU
ENST00000367623 MI0003657 hsa-miR-642 GUCCCUCUCCAAAUGUGUCUUG
ENST00000367623 MI0003660 hsa-miR-645 UCUAGGCUGGUACUGCUGA
ENST00000367623 MI0000263 hsa-miR-7 UGGAAGACUAGUGAUUUUGUUGU
ENST00000367623 MI0000264 hsa-miR-7 UGGAAGACUAGUGAUUUUGUUGU
ENST00000367623 MI0000265 hsa-miR-7 UGGAAGACUAGUGAUUUUGUUGU
ENST00000367623 MI0005561 hsa-miR-877* UCCUCUUCUCCCUCCUCCCAG
ENST00000367623 MI0005716 hsa-miR-924 AGAGUCUUGUGAUGUCUUGC
ENST00000367623 MI0002401 mmu-miR-466a-5p UAUGUGUGUGUACAUGUACAUA
ENST00000367623 MI0005502 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENST00000367623 MI0005503 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENST00000367623 MI0005504 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENST00000367623 MI0005505 mmu-miR-466c-5p GAUGUGUGUGUGCAUGUACAUA
ENST00000367623 MI0005546 mmu-miR-466d-5p UGUGUGUGCGUACAUGUACAUG
ENST00000367623 MI0005506 mmu-miR-466e-5p GAUGUGUGUGUACAUGUACAUA
ENST00000367623 MI0005511 mmu-miR-466h UGUGUGCAUGUGCUUGUGUGUA
ENST00000367623 MI0004647 mmu-miR-684 AGUUUUCCCUUCAAGUCAA
ENST00000367623 MI0004648 mmu-miR-684 AGUUUUCCCUUCAAGUCAA
ENST00000367623 MI0004684 mmu-miR-700 CACGCGGGAACCGAGUCCACC
ENST00000367623 MI0004707 mmu-miR-718 CUUCCGCCCGGCCGGGUGUCG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

[ - ] Somatic Mutations in Cancer - Sanger's COSMIC

The mutation data was obtained from the Sanger Institute Catalogue Of Somatic Mutations In Cancer web site, http://www.sanger.ac.uk/cosmic Bamford et al (2004) The COSMIC (Catalogue of Somatic Mutations in Cancer) database and website. Br J Cancer, 91,355-358.
Mutation (top 10)Total Observations
c.187G>C1
c.1427delC1
c.1448G>T1
c.2371delG1
Primary Site / Histology (Top 10)Mutations (sites * observations)
lung / carcinoma2
breast / carcinoma1
ovary / carcinoma1

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
sodium arsenite
  • sodium arsenite results in increased expression of ABL2 mRNA
12760830
Taurine
  • Taurine results in increased expression of ABL2 mRNA
16579726

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Liver Cirrhosis, Experimental inferred via Taurine 15893842, 15931870
Adrenal Gland Neoplasms inferred via sodium arsenite 15276417
Adrenocortical Adenoma inferred via sodium arsenite 16712894
Carcinoma, Hepatocellular inferred via sodium arsenite 15276417, 16507464
Carcinoma, Squamous Cell inferred via sodium arsenite 18572023
Genital Neoplasms, Female inferred via sodium arsenite 16452187
Hodgkin Disease inferred via sodium arsenite 12676792
Liver Neoplasms inferred via sodium arsenite 15276417, 16712894
Lung Neoplasms inferred via sodium arsenite 15276417, 16712894, 17077188
Melanoma inferred via sodium arsenite 16487513
Neoplasms inferred via sodium arsenite 11559025
Neural Tube Defects inferred via sodium arsenite 12854658
Ovarian Neoplasms inferred via sodium arsenite 15276417
Prostatic Neoplasms inferred via sodium arsenite 16039940
Skin Neoplasms inferred via sodium arsenite 18572023
Spinal Dysraphism inferred via sodium arsenite 12854658
Urinary Bladder Neoplasms inferred via sodium arsenite 11723127, 16452187, 16712894
Uterine Cervical Neoplasms inferred via sodium arsenite 11813266
Vascular Diseases inferred via sodium arsenite 17056641

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
ABL1 ABL1 / ABL2 Affinity Capture-Western Cao C (2003)
ABL1 ABL2 / ABL1 Affinity Capture-Western Cao C (2003)
ABL1 ABL1 / ABL2 Reconstituted Complex Cao C (2003)
ARGBP2 ABL2 / ARGBP2 Biochemical Activity Wang B (1997)
ARGBP2 ARGBP2 / ABL2 Reconstituted Complex Wang B (1997)
ARGBP2 ABL2 / ARGBP2 Two-hybrid Wang B (1997)
CAT ABL2 / CAT Affinity Capture-Western Cao C (2003)
CAT CAT / ABL2 Affinity Capture-Western Cao C (2003)
CAT ABL2 / CAT Biochemical Activity Cao C (2003)
CAT ABL2 / CAT Reconstituted Complex Cao C (2003)
JAK1 JAK1 / ABL2 Affinity Capture-Western Danial NN (1998)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Srinivasan D, et al. (2009) "Reciprocal regulation of Abl and receptor tyrosine kinases." Cell Signal. 21(7):1143-1150. PMID:19275932
  2. [ + ] Bianchi C, et al. (2008) "Eight full-length abelson related gene (Arg) isoforms are constitutively expressed in caki-1 cell line and cell distribution of two isoforms has been analyzed after transfection." J Cell Biochem. 105(5):1219-1227. PMID:18810762
  3. [ + ] Shimizu A, et al. (2008) "ABL2/ARG tyrosine kinase mediates SEMA3F-induced RhoA inactivation and cytoskeleton collapse in human glioma cells." J Biol Chem. 283(40):27230-27238. PMID:18660502
  4. [ + ] Wissing J, et al. (2007) "Proteomics analysis of protein kinases by target class-selective prefractionation and tandem mass spectrometry." Mol Cell Proteomics. 6(3):537-547. PMID:17192257
  5. [ + ] Wu C, et al. (2007) "Systematic identification of SH3 domain-mediated human protein-protein interactions by peptide array target screening." Proteomics. 7(11):1775-1785. PMID:17474147
  6. [ + ] Liu X, et al. (2006) "Interaction between c-Abl and Arg tyrosine kinases and proteasome subunit PSMA7 regulates proteasome degradation." Mol Cell. 22(3):317-327. PMID:16678104
  7. [ + ] Olsen JV, et al. (2006) "Global, in vivo, and site-specific phosphorylation dynamics in signaling networks." Cell. 127(3):635-648. PMID:17081983
  8. [ + ] Gregory SG, et al. (2006) "The DNA sequence and biological annotation of human chromosome 1." Nature. 441(7091):315-321. PMID:16710414
  9. [ + ] Kimura K, et al. (2006) "Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes." Genome Res. 16(1):55-65. PMID:16344560
  10. [ + ] Cao C, et al. (2005) "Ubiquitination and degradation of the Arg tyrosine kinase is regulated by oxidative stress." Oncogene. 24(15):2433-2440. PMID:15735735
  11. [ + ] Hu H, et al. (2005) "RIN1 is an ABL tyrosine kinase activator and a regulator of epithelial-cell adhesion and migration." Curr Biol. 15(9):815-823. PMID:15886098
  12. [ + ] Perego RA, et al. (2005) "N- and C-terminal isoforms of Arg quantified by real-time PCR are specifically expressed in human normal and neoplastic cells, in neoplastic cell lines, and in HL-60 cell differentiation." Mol Carcinog. 42(4):229-239. PMID:15765532
  13. [ + ] Okuda K, et al. (2005) "Signal transduction and cellular functions of the TEL/ARG oncoprotein." Leukemia. 19(4):603-610. PMID:15729383
  14. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  15. [ + ] Sasaki H, et al. (2004) "Arg and DAP3 expression was correlated with human thymoma stage." Clin Exp Metastasis. 21(6):507-513. PMID:15679048
  16. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  17. [ + ] Cao C, et al. (2003) "Catalase is regulated by ubiquitination and proteosomal degradation. Role of the c-Abl and Arg tyrosine kinases." Biochemistry. 42(35):10348-10353. PMID:12950161
  18. [ + ] Salomon AR, et al. (2003) "Profiling of tyrosine phosphorylation pathways in human cells using mass spectrometry." Proc Natl Acad Sci U S A. 100(2):443-448. PMID:12522270
  19. [ + ] Cao C, et al. (2003) "Functional interaction between the c-Abl and Arg protein-tyrosine kinases in the oxidative stress response." J Biol Chem. 278(15):12961-12967. PMID:12569093
  20. [ + ] Tanis KQ, et al. (2003) "Two distinct phosphorylation pathways have additive effects on Abl family kinase activation." Mol Cell Biol. 23(11):3884-3896. PMID:12748290
  21. [ + ] Cao C, et al. (2003) "Catalase activity is regulated by c-Abl and Arg in the oxidative stress response." J Biol Chem. 278(32):29667-29675. PMID:12777400
  22. [ + ] Cao C, et al. (2003) "Glutathione peroxidase 1 is regulated by the c-Abl and Arg tyrosine kinases." J Biol Chem. 278(41):39609-39614. PMID:12893824
  23. [ + ] Endo A, et al. (2002) "Sphingosine 1-phosphate induces membrane ruffling and increases motility of human umbilical vein endothelial cells via vascular endothelial growth factor receptor and CrkII." J Biol Chem. 277(26):23747-23754. PMID:11956190
  24. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  25. [ + ] Griesinger F, et al. (2002) "Identification of an ETV6-ABL2 fusion transcript in combination with an ETV6 point mutation in a T-cell acute lymphoblastic leukaemia cell line." Br J Haematol. 119(2):454-458. PMID:12406085
  26. [ + ] Pendergast AM, et al. (2002) "The Abl family kinases: mechanisms of regulation and signaling." Adv Cancer Res. 85():51-100. PMID:12374288
  27. [ + ] Bianchi C, et al. (2002) "The expression of the non-receptor tyrosine kinases Arg and c-abl is differently modulated in B lymphoid cells at different stages of differentiation." FEBS Lett. 527(1-3):216-222. PMID:12220663
  28. [ + ] Abassi YA, et al. (2002) "Tyrosine 221 in Crk regulates adhesion-dependent membrane localization of Crk and Rac and activation of Rac signaling." EMBO J. 21(17):4571-4582. PMID:12198159
  29. [ + ] Cao C, et al. (2001) "The ARG tyrosine kinase interacts with Siva-1 in the apoptotic response to oxidative stress." J Biol Chem. 276(15):11465-11468. PMID:11278261
  30. [ + ] Yu HH, et al. (2001) "Multiple signaling interactions of Abl and Arg kinases with the EphB2 receptor." Oncogene. 20(30):3995-4006. PMID:11494128
  31. [ + ] Iijima Y, et al. (2000) "A new ETV6/TEL partner gene, ARG (ABL-related gene or ABL2), identified in an AML-M3 cell line with a t(1;12)(q25;p13) translocation." Blood. 95(6):2126-2131. PMID:10706884
  32. [ + ] Chen WS, et al. (1999) "Comparative tyrosine-kinase profiles in colorectal cancers: enhanced arg expression in carcinoma as compared with adenoma and normal mucosa." Int J Cancer. 83(5):579-584. PMID:10521789
  33. [ + ] Cazzaniga G, et al. (1999) "The tyrosine kinase abl-related gene ARG is fused to ETV6 in an AML-M4Eo patient with a t(1;12)(q25;p13): molecular cloning of both reciprocal transcripts." Blood. 94(12):4370-4373. PMID:10590083
  34. [ + ] Danial NN, et al. (1998) "Direct interaction of Jak1 and v-Abl is required for v-Abl-induced activation of STATs and proliferation." Mol Cell Biol. 18(11):6795-6804. PMID:9774693
  35. [ + ] Hashimoto Y, et al. (1998) "Phosphorylation of CrkII adaptor protein at tyrosine 221 by epidermal growth factor receptor." J Biol Chem. 273(27):17186-17191. PMID:9642287
  36. [ + ] Koval AP, et al. (1998) "Interaction in vitro of the product of the c-Crk-II proto-oncogene with the insulin-like growth factor I receptor." Biochem J. 330 ( Pt 2)():923-932. PMID:9480911
  37. [ + ] Wang B, et al. (1997) "ArgBP2, a multiple Src homology 3 domain-containing, Arg/Abl-interacting protein, is phosphorylated in v-Abl-transformed cells and localized in stress fibers and cardiocyte Z-disks." J Biol Chem. 272(28):17542-17550. PMID:9211900
  38. [ + ] Suzuki Y, et al. (1997) "Construction and characterization of a full length-enriched and a 5'-end-enriched cDNA library." Gene. 200(1-2):149-156. PMID:9373149
  39. [ + ] Wang B, et al. (1996) "Subcellular localization of the Arg protein tyrosine kinase." Oncogene. 13(1):193-197. PMID:8700546
  40. [ + ] Wang B, et al. (1996) "Proline-rich sequences mediate the interaction of the Arg protein tyrosine kinase with Crk." Oncogene. 13(7):1379-1385. PMID:8875975
  41. [ + ] Maruyama K, et al. (1994) "Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides." Gene. 138(1-2):171-174. PMID:8125298
  42. [ + ] Muller AJ, et al. (1992) "A limited set of SH2 domains binds BCR through a high-affinity phosphotyrosine-independent interaction." Mol Cell Biol. 12(11):5087-5093. PMID:1383690
  43. [ + ] Kruh GD, et al. (1990) "The complete coding sequence of arg defines the Abelson subfamily of cytoplasmic tyrosine kinases." Proc Natl Acad Sci U S A. 87(15):5802-5806. PMID:2198571
  44. [ + ] Kruh GD, et al. (1986) "A novel human gene closely related to the abl proto-oncogene." Science. 234(4783):1545-1548. PMID:3787260