abf-1 | GeneID:266827 | Caenorhabditis elegans

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 266827 Official Symbol abf-1
Locus C50F2.9 Gene Type protein-coding
Synonyms
Full Name N/A
Description AntiBacterial Factor related
Chromosome N/A
Also Known As AntiBacterial Factor related family member (abf-1)
Summary N/A

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_058852 NP_491253

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
C50F2.9 MI0000002 cel-lin-4 UCCCUGAGACCUCAAGUGUGA
C50F2.9 MI0000312 cel-miR-237 UCCCUGAGAAUUCUCGAACAGCU
C50F2.9 MI0000038 cel-miR-67 UCACAACCUCCUAGAAAGAGUAGA
C50F2.9 MI0005184 cel-miR-784 UGGCACAAUCUGCGUACGUAGA
C50F2.9 MI0005188 cel-miR-788 UCCGCUUCUAACUUCCAUUUGCAG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

NM_058852  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene