AATF | GeneID:26574 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 26574 Official Symbol AATF
Locus N/A Gene Type protein-coding
Synonyms CHE-1; CHE1; DED
Full Name apoptosis antagonizing transcription factor
Description apoptosis antagonizing transcription factor
Chromosome 17q11.2-q12
Also Known As
Summary The protein encoded by this gene was identified on the basis of its interaction with MAP3K12/DLK, a protein kinase known to be involved in the induction of cell apoptosis. This gene product contains a leucine zipper, which is a characteristic motif of transcription factors, and was shown to exhibit strong transactivation activity when fused to Gal4 DNA binding domain. Overexpression of this gene interfered with MAP3K12 induced apoptosis. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 40811

ID Symbol Protein Species
GeneID:26574 AATF NP_036270.1 Homo sapiens
GeneID:33943 CG11188 NP_609066.1 Drosophila melanogaster
GeneID:56321 Aatf NP_062790.1 Mus musculus
GeneID:114512 Aatf NP_446172.1 Rattus norvegicus
GeneID:171723 Y73E7A.2 NP_490870.2 Caenorhabditis elegans
GeneID:417653 AATF NP_001025895.1 Gallus gallus
GeneID:454601 AATF XP_511427.2 Pan troglodytes
GeneID:480595 AATF XP_537715.2 Canis lupus familiaris
GeneID:559477 aatf NP_001077297.1 Danio rerio
GeneID:786013 AATF XP_001252958.1 Bos taurus
GeneID:836254 AT5G61330 NP_200941.2 Arabidopsis thaliana
GeneID:851893 BFR2 NP_010585.1 Saccharomyces cerevisiae
GeneID:1269788 AgaP_AGAP007394 XP_308438.2 Anopheles gambiae
GeneID:2543540 SPAC664.08c NP_593456.1 Schizosaccharomyces pombe
GeneID:2677840 MGG_04641 XP_362196.2 Magnaporthe grisea
GeneID:2706053 NCU04787.1 XP_324144.1 Neurospora crassa
GeneID:2892016 KLLA0C10362g XP_452661.1 Kluyveromyces lactis
GeneID:4323936 Os01g0526200 NP_001043227.1 Oryza sativa
GeneID:4618523 AGOS_AAL064W NP_982478.1 Eremothecium gossypii

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab39631 AATF antibody (ab39631); Rabbit polyclonal to AATF
2 abcam ab66649 AATF antibody (ab66649); Rabbit polyclonal to AATF
3 abcam ab72148 AATF antibody (ab72148); Rabbit polyclonal to AATF
4 abcam ab65248 AATF antibody (ab65248); Rabbit polyclonal to AATF
5 abcam ab50826 AATF antibody [AATF2B6] (ab50826); Mouse monoclonal [AATF2B6] to AATF
6 abnova H00026574-M04 AATF monoclonal antibody (M04), clone 3C7; Mouse monoclonal antibody raised against a partial recombinant AATF.
7 abnova H00026574-M09 AATF monoclonal antibody (M09), clone 2H6; Mouse monoclonal antibody raised against a partial recombinant AATF.
8 acris AP07651PU-N AATF; antibody Ab
9 scbt AATF AATF Antibody / AATF Antibodies;
10 sigma HPA004940 Anti-AATF antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of AATF Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of AATF Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0030054 Component cell junction
GO:0005813 Component centrosome
GO:0005925 Component focal adhesion
GO:0005730 Component nucleolus
GO:0005634 Component nucleus
GO:0005515 Function protein binding
GO:0003700 Function transcription factor activity
GO:0006916 Process anti-apoptosis

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_012138  UCSC Browser NP_036270

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000225402 MI0000108 hsa-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENST00000225402 MI0000109 hsa-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENST00000225402 MI0000114 hsa-miR-107 AGCAGCAUUGUACAGGGCUAUCA
ENST00000225402 MI0000443 hsa-miR-124 UAAGGCACGCGGUGAAUGCC
ENST00000225402 MI0000444 hsa-miR-124 UAAGGCACGCGGUGAAUGCC
ENST00000225402 MI0000445 hsa-miR-124 UAAGGCACGCGGUGAAUGCC
ENST00000225402 MI0000458 hsa-miR-142-5p CAUAAAGUAGAAAGCACUACU
ENST00000225402 MI0003129 hsa-miR-146b-3p UGCCCUGUGGACUCAGUUCUGG
ENST00000225402 MI0000285 hsa-miR-205 UCCUUCAUUCCACCGGAGUCUG
ENST00000225402 MI0000300 hsa-miR-223* CGUGUAUUUGACAAGCUGAGUU
ENST00000225402 MI0000301 hsa-miR-224 CAAGUCACUAGUGGUUCCGUU
ENST00000225402 MI0000080 hsa-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENST00000225402 MI0000081 hsa-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENST00000225402 MI0000080 hsa-miR-24-1* UGCCUACUGAGCUGAUAUCAGU
ENST00000225402 MI0000081 hsa-miR-24-2* UGCCUACUGAGCUGAAACACAG
ENST00000225402 MI0000747 hsa-miR-296-3p GAGGGUUGGGUGGAGGCUCUCC
ENST00000225402 MI0000105 hsa-miR-29b-1* GCUGGUUUCAUAUGGUGGUUUAGA
ENST00000225402 MI0000107 hsa-miR-29b-2* CUGGUUUCACAUGGUGGCUUAG
ENST00000225402 MI0000824 hsa-miR-325 CCUAGUAGGUGUCCAGUAAGUGU
ENST00000225402 MI0000268 hsa-miR-34a UGGCAGUGUCUUAGCUGGUUGU
ENST00000225402 MI0000778 hsa-miR-370 GCCUGCUGGGGUGGAACCUGGU
ENST00000225402 MI0000786 hsa-miR-378 ACUGGACUUGGAGUCAGAAGG
ENST00000225402 MI0002464 hsa-miR-412 ACUUCACCUGGUCCACUAGCCGU
ENST00000225402 MI0002470 hsa-miR-486-3p CGGGGCAGCUCAGUACAGGAU
ENST00000225402 MI0003186 hsa-miR-502-5p AUCCUUGCUAUCUGGGUGCUA
ENST00000225402 MI0003140 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENST00000225402 MI0003141 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENST00000225402 MI0003153 hsa-miR-523 GAACGCGCUUCCCUAUAGAGGGU
ENST00000225402 MI0003160 hsa-miR-524-3p GAAGGCGCUUCCCUUUGGAGU
ENST00000225402 MI0003152 hsa-miR-525-3p GAAGGCGCUUCCCUUUAGAGCG
ENST00000225402 MI0003568 hsa-miR-562 AAAGUAGCUGUACCAUUUGC
ENST00000225402 MI0003570 hsa-miR-564 AGGCACGGUGUCAGCAGGC
ENST00000225402 MI0003589 hsa-miR-582-3p UAACUGGUUGAACAACUGAACC
ENST00000225402 MI0003605 hsa-miR-593* AGGCACCAGCCAGGCAUUGCUCAGC
ENST00000225402 MI0003629 hsa-miR-616 AGUCAUUGGAGGGUUUGAGCAG
ENST00000225402 MI0003635 hsa-miR-621 GGCUAGCAACAGCGCUUACCU
ENST00000225402 MI0003649 hsa-miR-634 AACCAGCACCCCAACUUUGGAC
ENST00000225402 MI0003661 hsa-miR-646 AAGCAGCUGCCUCUGAGGC
ENST00000225402 MI0003667 hsa-miR-652 AAUGGCGCCACUAGGGUUGUG
ENST00000225402 MI0003676 hsa-miR-654-5p UGGUGGGCCGCAGAACAUGUGC
ENST00000225402 MI0003684 hsa-miR-660 UACCCAUUGCAUAUCGGAGUUG
ENST00000225402 MI0003672 hsa-miR-663 AGGCGGGGCGCCGCGGGACCGC
ENST00000225402 MI0005538 hsa-miR-892b CACUGGCUCCUUUCUGGGUAGA
ENST00000225402 MI0000093 hsa-miR-92a-1* AGGUUGGGAUCGGUUGCAAUGCU
ENST00000225402 MI0002400 mmu-miR-465a-3p GAUCAGGGCCUUUCUAAGUAGA
ENST00000225402 MI0004675 mmu-miR-695 AGAUUGGGCAUAGGUGACUGAA
ENST00000225402 MI0004696 mmu-miR-712 CUCCUUCACCCGGGCGGUACC
ENST00000225402 MI0004215 mmu-miR-762 GGGGCUGGGGCCGGGACAGAGC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Ethinyl Estradiol
  • Ethinyl Estradiol affects the expression of AATF mRNA
17555576
Ethinyl Estradiol
  • Ethinyl Estradiol results in increased expression of AATF mRNA
16174780
Flavonoids
  • Flavonoids results in decreased expression of AATF mRNA
18035473
Tamoxifen
  • Tamoxifen affects the expression of AATF mRNA
17555576

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Breast Neoplasms inferred via Tamoxifen 16202921, 15565566, 17242785, 16818667, 17049068, 17893378, 15668708, 17440819, 17261762, 16873071, 11161223
Carcinoma, Hepatocellular inferred via Tamoxifen 16924424
Carcinoma, Transitional Cell inferred via Tamoxifen 17572228
Endometrial Neoplasms inferred via Tamoxifen 16202921, 17893378
Fatty Liver inferred via Tamoxifen 14986274
Female Urogenital Diseases inferred via Tamoxifen 16709447
Lipidoses inferred via Tamoxifen 15342952
Liver Cirrhosis, Experimental inferred via Tamoxifen 18564211
Liver Neoplasms inferred via Tamoxifen 16684651
Mammary Neoplasms, Experimental inferred via Tamoxifen 11731420, 14580682, 16827153
Melanoma inferred via Tamoxifen 12393984
Melanoma, Amelanotic inferred via Tamoxifen 15990972
Spermatocele inferred via Tamoxifen 16709447
Urinary Bladder Neoplasms inferred via Tamoxifen 16712894, 17572228
Inflammation inferred via Flavonoids 17296493
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 16919318, 17681005, 15861022, 16105132, 17333356, 11677210
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
DAZAP2 DAZAP2 / AATF Two-hybrid Rual JF (2005)
LDOC1 LDOC1 / AATF Two-hybrid Rual JF (2005)
MAPT AATF / MAPT FRET Barbato C (2003)
MPP6 MPP6 / AATF Two-hybrid Lehner B (2004)
PAWR AATF / PAWR Affinity Capture-Western Guo Q (2004)
PAWR PAWR / AATF Affinity Capture-Western Guo Q (2004)
POLR2J POLR2J / AATF Reconstituted Complex Fanciulli M (2000)
POLR2J POLR2J / AATF Two-hybrid Fanciulli M (2000)
RB1 AATF / RB1 Affinity Capture-Western Bruno T (2002)
RB1 RB1 / AATF Affinity Capture-Western Bruno T (2002)
RB1 AATF / RB1 Affinity Capture-Western Fanciulli M (2000)
RB1 RB1 / AATF Affinity Capture-Western Fanciulli M (2000)
RB1 AATF / RB1 Reconstituted Complex Fanciulli M (2000)
RB1 RB1 / AATF Reconstituted Complex Fanciulli M (2000)
RB1 AATF / RB1 Two-hybrid Bruno T (2002)
RBL1 AATF / RBL1 Affinity Capture-Western Bruno T (2002)
RBL2 AATF / RBL2 Affinity Capture-Western Bruno T (2002)
SP1 SP1 / AATF Affinity Capture-Western Di Padova M (2003)
SP1 SP1 / AATF Reconstituted Complex Di Padova M (2003)
Tsg101 Tsg101 / AATF Reconstituted Complex Burgdorf S (2004)
Tsg101 AATF / Tsg101 Two-hybrid Burgdorf S (2004)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Barbe L, et al. (2008) "Toward a confocal subcellular atlas of the human proteome." Mol Cell Proteomics. 7(3):499-508. PMID:18029348
  2. [ + ] Kaul D, et al. (2007) "Cellular AATF gene: armour against HIV-1." Indian J Biochem Biophys. 44(5):276-278. PMID:18341201
  3. [ + ] Kaul D, et al. (2007) "Functional characterization of AATF transcriptome in human leukemic cells." Mol Cell Biochem. 297(1-2):215-220. PMID:17006618
  4. [ + ] De Nicola F, et al. (2007) "The prolyl isomerase Pin1 affects Che-1 stability in response to apoptotic DNA damage." J Biol Chem. 282(27):19685-19691. PMID:17468107
  5. [ + ] Di Certo MG, et al. (2007) "NRAGE associates with the anti-apoptotic factor Che-1 and regulates its degradation to induce cell death." J Cell Sci. 120(Pt 11):1852-1858. PMID:17488777
  6. [ + ] Nousiainen M, et al. (2006) "Phosphoproteome analysis of the human mitotic spindle." Proc Natl Acad Sci U S A. 103(14):5391-5396. PMID:16565220
  7. [ + ] Bruno T, et al. (2006) "Che-1 phosphorylation by ATM/ATR and Chk2 kinases activates p53 transcription and the G2/M checkpoint." Cancer Cell. 10(6):473-486. PMID:17157788
  8. [ + ] Olsen JV, et al. (2006) "Global, in vivo, and site-specific phosphorylation dynamics in signaling networks." Cell. 127(3):635-648. PMID:17081983
  9. [ + ] Andersen JS, et al. (2005) "Nucleolar proteome dynamics." Nature. 433(7021):77-83. PMID:15635413
  10. [ + ] Rual JF, et al. (2005) "Towards a proteome-scale map of the human protein-protein interaction network." Nature. 437(7062):1173-1178. PMID:16189514
  11. [ + ] Xie J, et al. (2004) "AATF protects neural cells against oxidative damage induced by amyloid beta-peptide." Neurobiol Dis. 16(1):150-157. PMID:15207272
  12. [ + ] Guo Q, et al. (2004) "AATF inhibits aberrant production of amyloid beta peptide 1-42 by interacting directly with Par-4." J Biol Chem. 279(6):4596-4603. PMID:14627703
  13. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  14. [ + ] Burgdorf S, et al. (2004) "TSG101 interacts with apoptosis-antagonizing transcription factor and enhances androgen receptor-mediated transcription by promoting its monoubiquitination." J Biol Chem. 279(17):17524-17534. PMID:14761944
  15. [ + ] Lehner B, et al. (2004) "A protein interaction framework for human mRNA degradation." Genome Res. 14(7):1315-1323. PMID:15231747
  16. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  17. [ + ] Barbato C, et al. (2003) "Rb binding protein Che-1 interacts with Tau in cerebellar granule neurons. Modulation during neuronal apoptosis." Mol Cell Neurosci. 24(4):1038-1050. PMID:14697667
  18. [ + ] Di Padova M, et al. (2003) "Che-1 arrests human colon carcinoma cell proliferation by displacing HDAC1 from the p21WAF1/CIP1 promoter." J Biol Chem. 278(38):36496-36504. PMID:12847090
  19. [ + ] Andersen JS, et al. (2002) "Directed proteomic analysis of the human nucleolus." Curr Biol. 12(1):1-11. PMID:11790298
  20. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  21. [ + ] Bruno T, et al. (2002) "Che-1 affects cell growth by interfering with the recruitment of HDAC1 by Rb." Cancer Cell. 2(5):387-399. PMID:12450794
  22. [ + ] Scherl A, et al. (2002) "Functional proteomic analysis of human nucleolus." Mol Biol Cell. 13(11):4100-4109. PMID:12429849
  23. [ + ] Fanciulli M, et al. (2000) "Identification of a novel partner of RNA polymerase II subunit 11, Che-1, which interacts with and affects the growth suppression function of Rb." FASEB J. 14(7):904-912. PMID:10783144
  24. [ + ] Lindfors K, et al. (2000) "Identification of novel transcription factor-like gene from human intestinal cells." Biochem Biophys Res Commun. 276(2):660-666. PMID:11027528
  25. [ + ] Page G, et al. (1999) "AATF, a novel transcription factor that interacts with Dlk/ZIP kinase and interferes with apoptosis." FEBS Lett. 462(1-2):187-191. PMID:10580117