LATS2 | GeneID:26524 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 26524 Official Symbol LATS2
Locus N/A Gene Type protein-coding
Synonyms FLJ13161; KPM
Full Name LATS, large tumor suppressor, homolog 2 (Drosophila)
Description LATS, large tumor suppressor, homolog 2 (Drosophila)
Chromosome 13q11-q12
Also Known As LATS (large tumor suppressor, Drosophila) homolog 2; LATS, large tumor suppressor, homolog 2; OTTHUMP00000018106; kinase phosphorylated during mitosis protein; serine/threonine kinase KPM; warts-like kinase
Summary This gene encodes a serine/threonine protein kinase belonging to the LATS tumor suppressor family. The protein localizes to centrosomes during interphase, and early and late metaphase. It interacts with the centrosomal proteins aurora-A and ajuba and is required for accumulation of gamma-tubulin and spindle formation at the onset of mitosis. It also interacts with a negative regulator of p53 and may function in a positive feedback loop with p53 that responds to cytoskeleton damage. Additionally, it can function as a co-repressor of androgen-responsive gene expression. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 56678

ID Symbol Protein Species
GeneID:26524 LATS2 NP_055387.2 Homo sapiens
GeneID:50523 Lats2 NP_056586.2 Mus musculus
GeneID:305922 Lats2 XP_224169.2 Rattus norvegicus
GeneID:418949 LATS2 XP_417143.2 Gallus gallus
GeneID:452466 LATS2 XP_509566.2 Pan troglodytes
GeneID:477343 LATS2 XP_534537.2 Canis lupus familiaris
GeneID:508208 LATS2 XP_584953.3 Bos taurus
GeneID:2680527 MGG_09519 XP_364674.2 Magnaporthe grisea

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab54073 LATS2 antibody [mAbcam54073] (ab54073); Mouse monoclonal [mAbcam54073] to LATS2
2 abcam ab70565 LATS2 antibody (ab70565); Rabbit polyclonal to LATS2
3 abgent AP7035c LATS2 Antibody (Center); Purified Rabbit Polyclonal Antibody (Pab)
4 acris AP13576PU-N LATS2 (Center); antibody Ab
5 scbt LATS2 LATS2 Antibody / LATS2 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of LATS2 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of LATS2 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005813 Component centrosome
GO:0005737 Component cytoplasm
GO:0005634 Component nucleus
GO:0000922 Component spindle pole
GO:0005524 Function ATP binding
GO:0000287 Function magnesium ion binding
GO:0000166 Function nucleotide binding
GO:0004674 Function protein serine/threonine kinase activity
GO:0016740 Function transferase activity
GO:0051301 Process cell division
GO:0000082 Process G1/S transition of mitotic cell cycle
GO:0009755 Process hormone-mediated signaling
GO:0007067 Process mitosis
GO:0045736 Process negative regulation of cyclin-dependent protein kinase activity
GO:0006468 Process protein amino acid phosphorylation
GO:0007243 Process protein kinase cascade

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_014572  UCSC Browser NP_055387

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000382592 MI0000064 hsa-let-7c* UAGAGUUACACCCUGGGAGUUA
ENST00000382592 MI0000342 hsa-miR-200b UAAUACUGCCUGGUAAUGAUGA
ENST00000382592 MI0000650 hsa-miR-200c UAAUACUGCCGGGUAAUGAUGGA
ENST00000382592 MI0000805 hsa-miR-342-3p UCUCACACAGAAAUCGCACCCGU
ENST00000382592 MI0001735 hsa-miR-409-5p AGGUUACCCGAGCAACUUUGCAU
ENST00000382592 MI0001729 hsa-miR-451 AAACCGUUACCAUUACUGAGUU
ENST00000382592 MI0003149 hsa-miR-520a-3p AAAGUGCUUCCCUUUGGACUGU
ENST00000382592 MI0000244 mmu-miR-201 UACUCAGUAAGGCAUUGUUCUU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

[ - ] Somatic Mutations in Cancer - Sanger's COSMIC

The mutation data was obtained from the Sanger Institute Catalogue Of Somatic Mutations In Cancer web site, http://www.sanger.ac.uk/cosmic Bamford et al (2004) The COSMIC (Catalogue of Somatic Mutations in Cancer) database and website. Br J Cancer, 91,355-358.
Mutation (top 10)Total Observations
c.119G>A1
c.2775G>A1
c.2859C>A1
Primary Site / Histology (Top 10)Mutations (sites * observations)
lung / carcinoma2
ovary / carcinoma1

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen affects the expression of LATS2 mRNA
17562736
Carbon Tetrachloride
  • Carbon Tetrachloride affects the expression of LATS2 mRNA
17484886

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 16050911, 15673190, 16011737, 15700767, 16124888, 16227642, 10355542, 16097048
Fatty Liver inferred via Carbon Tetrachloride 16045604, 16239168, 12795759, 61145, 12631006, 17595544, 15959796
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 15027814, 15968718, 16227642, 15998439, 16177239, 11566570
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 16943688, 16221502, 16239168, 17334410
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 17805973, 17976157, 18395095, 12666154, 18277467, 18205269, 14716496, 15730626, 12632514, 15052691, 12632512, 17766677, 18418968, 12667390, 14748882, 13678700, 15818738, 17631135, 16097048, 15673190, 12649538, 17721639, 18481824, 15057751, 12586293, 18054572, 10355542, 16011737, 18251166, 17823541, 17944888, 18376398, 12389079, 18187930, 18210741, 16015684, 12741479, 14724832, 18472094, 15931870, 17698563, 15893842, 12958196, 17640975, 18412020, 17714472, 14512876, 12609069, 18166357, 17922224, 18420326, 15876570, 12445421, 12445418, 15959796, 12898905, 18317297, 17761835, 14620537, 18472332, 14716833, 16136751, 17481882, 17900296, 15123356, 18339082, 18429990, 12546737, 18006644, 18395914, 18279442, 16027843, 15996030, 16033810, 17565644, 17869086, 17708605, 16638106, 18156304, 17557913, 17525996, 16116963, 16248980, 15925388
Liver Diseases inferred via Carbon Tetrachloride 16246199, 15830285, 17285989, 16964402, 15720792
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823
Hepatitis, Toxic inferred via Acetaminophen 2444490, 14986274, 16227642, 15968718, 16177239, 17562736, 16081117, 17522070
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Matsui Y, et al. (2008) "Lats2 is a negative regulator of myocyte size in the heart." Circ Res. 103(11):1309-1318. PMID:18927464
  2. [ + ] Kawahara M, et al. (2008) "Kpm/Lats2 is linked to chemosensitivity of leukemic cells through the stabilization of p73." Blood. 112(9):3856-3866. PMID:18565851
  3. [ + ] Abe Y, et al. (2006) "LATS2-Ajuba complex regulates gamma-tubulin recruitment to centrosomes and spindle organization during mitosis." FEBS Lett. 580(3):782-788. PMID:16413547
  4. [ + ] Jiang Z, et al. (2006) "Promoter hypermethylation-mediated down-regulation of LATS1 and LATS2 in human astrocytoma." Neurosci Res. 56(4):450-458. PMID:17049657
  5. [ + ] Aylon Y, et al. (2006) "A positive feedback loop between the p53 and Lats2 tumor suppressors prevents tetraploidization." Genes Dev. 20(19):2687-2700. PMID:17015431
  6. [ + ] Voorhoeve PM, et al. (2006) "A genetic screen implicates miRNA-372 and miRNA-373 as oncogenes in testicular germ cell tumors." Cell. 124(6):1169-1181. PMID:16564011
  7. [ + ] Chan EH, et al. (2005) "The Ste20-like kinase Mst2 activates the human large tumor suppressor kinase Lats1." Oncogene. 24(12):2076-2086. PMID:15688006
  8. [ + ] Takahashi Y, et al. (2005) "Down-regulation of LATS1 and LATS2 mRNA expression by promoter hypermethylation and its association with biologically aggressive phenotype in human breast cancers." Clin Cancer Res. 11(4):1380-1385. PMID:15746036
  9. [ + ] Ke H, et al. (2004) "Putative tumor suppressor Lats2 induces apoptosis through downregulation of Bcl-2 and Bcl-x(L)." Exp Cell Res. 298(2):329-338. PMID:15265683
  10. [ + ] Toji S, et al. (2004) "The centrosomal protein Lats2 is a phosphorylation target of Aurora-A kinase." Genes Cells. 9(5):383-397. PMID:15147269
  11. [ + ] Powzaniuk M, et al. (2004) "The LATS2/KPM tumor suppressor is a negative regulator of the androgen receptor." Mol Endocrinol. 18(8):2011-2023. PMID:15131260
  12. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  13. [ + ] Li Y, et al. (2003) "Lats2, a putative tumor suppressor, inhibits G1/S transition." Oncogene. 22(28):4398-4405. PMID:12853976
  14. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  15. [ + ] Yabuta N, et al. (2000) "Structure, expression, and chromosome mapping of LATS2, a mammalian homologue of the Drosophila tumor suppressor gene lats/warts." Genomics. 63(2):263-270. PMID:10673337
  16. [ + ] Hori T, et al. (2000) "Molecular cloning of a novel human protein kinase, kpm, that is homologous to warts/lats, a Drosophila tumor suppressor." Oncogene. 19(27):3101-3109. PMID:10871863