Abcg2 | GeneID:26357 | Mus musculus
Gene Summary
[
] NCBI Entrez Gene
| Gene ID | 26357 | Official Symbol | Abcg2 |
|---|---|---|---|
| Locus | N/A | Gene Type | protein-coding |
| Synonyms | ABC15; ABCP; AI428558; BCRP; Bcrp1; MXR; MXR1 | ||
| Full Name | ATP-binding cassette, sub-family G (WHITE), member 2 | ||
| Description | ATP-binding cassette, sub-family G (WHITE), member 2 | ||
| Chromosome | 6 B3|6 28.5 cM | ||
| Also Known As | ATP-binding cassette, sub-family G, member 2; OTTMUSP00000025071; OTTMUSP00000025391; mitoxantrone resistance protein 1 | ||
| Summary | The membrane-associated protein encoded by this gene is included in the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily. Alternatively referred to as a breast cancer resistance protein, the human protein functions as a xenobiotic transporter which may play a major role in multi-drug resistance. This protein likely serves as a cellular defense mechanism in response to mitoxantrone and anthracycline exposure. [provided by RefSeq] | ||
Orthologs and Paralogs
[
] Homologs - NCBI's HomoloGene Group: 55852
| ID | Symbol | Protein | Species |
|---|---|---|---|
| GeneID:9429 | ABCG2 | NP_004818.2 | Homo sapiens |
| GeneID:26357 | Abcg2 | NP_036050.1 | Mus musculus |
| GeneID:312382 | Abcg2 | NP_852046.1 | Rattus norvegicus |
| GeneID:423767 | ABCG2 | XP_421638.2 | Gallus gallus |
| GeneID:471251 | ABCG2 | XP_526633.2 | Pan troglodytes |
| GeneID:478472 | ABCG2 | XP_535650.2 | Canis lupus familiaris |
| GeneID:536203 | ABCG2 | NP_001032555.2 | Bos taurus |
| GeneID:735310 | abcg2d | NP_001036237.1 | Danio rerio |
| GeneID:811826 | PF14_0244 | XP_001348418.1 | Plasmodium falciparum |
| GeneID:830541 | AT5G06530 | NP_850781.2 | Arabidopsis thaliana |
| GeneID:850369 | ADP1 | NP_009937.2 | Saccharomyces cerevisiae |
| GeneID:2679509 | MGG_01563 | XP_363637.2 | Magnaporthe grisea |
| GeneID:2713604 | NCU02544.1 | XP_331743.1 | Neurospora crassa |
| GeneID:2892892 | KLLA0D04554g | XP_453265.1 | Kluyveromyces lactis |
| GeneID:4331674 | Os03g0157400 | NP_001049014.1 | Oryza sativa |
| GeneID:4621257 | AGOS_AER190W | NP_985047.1 | Eremothecium gossypii |
Antibodies
[
] Monoclonal and Polyclonal Antibodies
| No. | Provider | Product No. | Description |
|---|---|---|---|
| 1 | abcam | ab24115 | BCRP/ABCG2 antibody [BXP-53] (ab24115); Rat monoclonal [BXP-53] to BCRP/ABCG2 |
| 2 | abcam | ab24114 | BCRP/ABCG2 antibody [BXP-9] (ab24114); Rat monoclonal [BXP-9] to BCRP/ABCG2 |
| 3 | sigma | B7185 | Anti-Breast Cancer Resistance Protein antibody produced in rabbit ; |
Gene Classification
[
] Gene Ontology
| ID | Category | GO Term |
|---|---|---|
| GO:0016021 | Component | integral to membrane |
| GO:0016020 | Component | membrane |
| GO:0005886 | Component | plasma membrane |
| GO:0016887 | Function | ATPase activity |
| GO:0005524 | Function | ATP binding |
| GO:0017111 | Function | nucleoside-triphosphatase activity |
| GO:0000166 | Function | nucleotide binding |
| GO:0006810 | Process | transport |
MicroRNA and Targets
[
] MicroRNA Sequences and Transcript Targets from miRBase at Sanger
| RNA Target | miRNA # | mat miRNA | Mature miRNA Sequence |
|---|---|---|---|
| ENSMUST00000031822 | MI0000781 | hsa-miR-373 | GAAGUGCUUCGAUUUUGGGGUGU |
| ENSMUST00000031822 | MI0003156 | hsa-miR-518b | CAAAGCGCUCCCCUUUAGAGGU |
| ENSMUST00000031822 | MI0003159 | hsa-miR-518c | CAAAGCGCUUCUCUUUAGAGUGU |
| ENSMUST00000031822 | MI0003171 | hsa-miR-518d-3p | CAAAGCGCUUCCCUUUGGAGC |
| ENSMUST00000031822 | MI0003154 | hsa-miR-518f | GAAAGCGCUUCUCUUUAGAGG |
| ENSMUST00000031822 | MI0003162 | hsa-miR-519d | CAAAGUGCCUCCCUUUAGAGUG |
| ENSMUST00000031822 | MI0003145 | hsa-miR-519e | AAGUGCCUCCUUUUAGAGUGUU |
| ENSMUST00000031822 | MI0003149 | hsa-miR-520a-3p | AAAGUGCUUCCCUUUGGACUGU |
| ENSMUST00000031822 | MI0003155 | hsa-miR-520b | AAAGUGCUUCCUUUUAGAGGG |
| ENSMUST00000031822 | MI0003158 | hsa-miR-520c-3p | AAAGUGCUUCCUUUUAGAGGGU |
| ENSMUST00000031822 | MI0003164 | hsa-miR-520d-3p | AAAGUGCUUCUCUUUGGUGGGU |
| ENSMUST00000031822 | MI0003143 | hsa-miR-520e | AAAGUGCUUCCUUUUUGAGGG |
| ENSMUST00000031822 | MI0003146 | hsa-miR-520f | AAGUGCUUCCUUUUAGAGGGUU |
| ENSMUST00000031822 | MI0003166 | hsa-miR-520g | ACAAAGUGCUUCCCUUUAGAGUGU |
| ENSMUST00000031822 | MI0003175 | hsa-miR-520h | ACAAAGUGCUUCCCUUUAGAGU |
| ENSMUST00000031822 | MI0003648 | hsa-miR-633 | CUAAUAGUAUCUACCACAAUAAA |
| ENSMUST00000031822 | MI0005481 | mmu-miR-105 | CCAAGUGCUCAGAUGCUUGUGGU |
| ENSMUST00000031822 | MI0000406 | mmu-miR-106a | CAAAGUGCUAACAGUGCAGGUAG |
| ENSMUST00000031822 | MI0000407 | mmu-miR-106b | UAAAGUGCUGACAGUGCAGAU |
| ENSMUST00000031822 | MI0000256 | mmu-miR-122 | UGGAGUGUGACAAUGGUGUUUG |
| ENSMUST00000031822 | MI0000687 | mmu-miR-17 | CAAAGUGCUUACAGUGCAGGUAG |
| ENSMUST00000031822 | MI0000568 | mmu-miR-20a | UAAAGUGCUUAUAGUGCAGGUAG |
| ENSMUST00000031822 | MI0003536 | mmu-miR-20b | CAAAGUGCUCAUAGUGCAGGUAG |
| ENSMUST00000031822 | MI0000388 | mmu-miR-290-3p | AAAGUGCCGCCUAGUUUUAAGCCC |
| ENSMUST00000031822 | MI0000389 | mmu-miR-291a-3p | AAAGUGCUUCCACUUUGUGUGC |
| ENSMUST00000031822 | MI0000389 | mmu-miR-291a-5p | CAUCAAAGUGGAGGCCCUCUCU |
| ENSMUST00000031822 | MI0003539 | mmu-miR-291b-3p | AAAGUGCAUCCAUUUUGUUUGU |
| ENSMUST00000031822 | MI0003539 | mmu-miR-291b-5p | GAUCAAAGUGGAGGCCCUCUCC |
| ENSMUST00000031822 | MI0000390 | mmu-miR-292-3p | AAAGUGCCGCCAGGUUUUGAGUGU |
| ENSMUST00000031822 | MI0000392 | mmu-miR-294 | AAAGUGCUUCCCUUUUGUGUGU |
| ENSMUST00000031822 | MI0000393 | mmu-miR-295 | AAAGUGCUACUACUUUUGAGUCU |
| ENSMUST00000031822 | MI0000401 | mmu-miR-301a | CAGUGCAAUAGUAUUGUCAAAGC |
| ENSMUST00000031822 | MI0004122 | mmu-miR-301b | CAGUGCAAUGGUAUUGUCAAAGC |
| ENSMUST00000031822 | MI0000402 | mmu-miR-302a | UAAGUGCUUCCAUGUUUUGGUGA |
| ENSMUST00000031822 | MI0003716 | mmu-miR-302b | UAAGUGCUUCCAUGUUUUAGUAG |
| ENSMUST00000031822 | MI0003717 | mmu-miR-302c | AAGUGCUUCCAUGUUUCAGUGG |
| ENSMUST00000031822 | MI0003718 | mmu-miR-302d | UAAGUGCUUCCAUGUUUGAGUGU |
| ENSMUST00000031822 | MI0002402 | mmu-miR-467a | UAAGUGCCUGCAUGUAUAUGCG |
| ENSMUST00000031822 | MI0004671 | mmu-miR-467b | GUAAGUGCCUGCAUGUAUAUG |
| ENSMUST00000031822 | MI0005513 | mmu-miR-467d | UAAGUGCGCGCAUGUAUAUGCG |
| ENSMUST00000031822 | MI0004708 | mmu-miR-721 | CAGUGCAAUUAAAAGGGGGAA |
| ENSMUST00000031822 | MI0004310 | mmu-miR-764-5p | GGUGCUCACAUGUCCUCCU |
| ENSMUST00000031822 | MI0000581 | mmu-miR-93 | CAAAGUGCUGUUCGUGCAGGUAG |
Selected Publications
[
] Gene-related publications indexed at PubMed
- [
] Scharenberg C, et al. (2009) "ABCG2 is expressed in late spermatogenesis and is associated with the acrosome." Biochem Biophys Res Commun. 378(2):302-307. PMID:19032939 - [
] Cattelotte J, et al. (2009) "Changes in dipole membrane potential at the mouse blood-brain barrier enhance the transport of 99mTechnetium Sestamibi more than inhibiting Abcb1, Abcc1, or Abcg2." J Neurochem. 108(3):767-775. PMID:19067785 - [
] Bleau AM, et al. (2009) "PTEN/PI3K/Akt pathway regulates the side population phenotype and ABCG2 activity in glioma tumor stem-like cells." Cell Stem Cell. 4(3):226-235. PMID:19265662 - [
] Shukla S, et al. (2009) "Curcumin inhibits the activity of ABCG2/BCRP1, a multidrug resistance-linked ABC drug transporter in mice." Pharm Res. 26(2):480-487. PMID:18841445 - [
] Zhou L, et al. (2008) "The breast cancer resistance protein (Bcrp1/Abcg2) limits fetal distribution of glyburide in the pregnant mouse: an Obstetric-Fetal Pharmacology Research Unit Network and University of Washington Specialized Center of Research Study." Mol Pharmacol. 73(3):949-959. PMID:18079276 - [
] Kim YJ, et al. (2008) "Comparative analysis of ABCG2-expressing and label-retaining cells in mouse submandibular gland." Cell Tissue Res. 334(1):47-53. PMID:18688650 - [
] Susanto J, et al. (2008) "Porphyrin homeostasis maintained by ABCG2 regulates self-renewal of embryonic stem cells." PLoS One. 3(12):e4023. PMID:19107196 - [
] Pfister O, et al. (2008) "Role of the ATP-binding cassette transporter Abcg2 in the phenotype and function of cardiac side population cells." Circ Res. 103(8):825-835. PMID:18787193 - [
] Muenster U, et al. (2008) "Characterization of substrates and inhibitors for the in vitro assessment of Bcrp mediated drug-drug interactions." Pharm Res. 25(10):2320-2326. PMID:18523872 - [
] Martin CM, et al. (2008) "Hypoxia-inducible factor-2alpha transactivates Abcg2 and promotes cytoprotection in cardiac side population cells." Circ Res. 102(9):1075-1081. PMID:18356544 - [
] Brendel C, et al. (2007) "Imatinib mesylate and nilotinib (AMN107) exhibit high-affinity interaction with ABCG2 on primitive hematopoietic stem cells." Leukemia. 21(6):1267-1275. PMID:17519960 - [
] Yamagata T, et al. (2007) "Improvement of the oral drug absorption of topotecan through the inhibition of intestinal xenobiotic efflux transporter, breast cancer resistance protein, by excipients." Drug Metab Dispos. 35(7):1142-1148. PMID:17446265 - [
] Pan G, et al. (2007) "Abcg2/Bcrp1 mediates the polarized transport of antiretroviral nucleosides abacavir and zidovudine." Drug Metab Dispos. 35(7):1165-1173. PMID:17437964 - [
] Jonker JW, et al. (2007) "Breast cancer resistance protein (Bcrp1/Abcg2) is expressed in the harderian gland and mediates transport of conjugated protoporphyrin IX." Am J Physiol Cell Physiol. 292(6):C2204-C2212. PMID:17314268 - [
] Bihorel S, et al. (2007) "Influence of breast cancer resistance protein (Abcg2) and p-glycoprotein (Abcb1a) on the transport of imatinib mesylate (Gleevec) across the mouse blood-brain barrier." J Neurochem. 102(6):1749-1757. PMID:17696988 - [
] Hasegawa M, et al. (2007) "Multidrug resistance-associated protein 4 is involved in the urinary excretion of hydrochlorothiazide and furosemide." J Am Soc Nephrol. 18(1):37-45. PMID:17135398 - [
] van Herwaarden AE, et al. (2007) "Multidrug transporter ABCG2/breast cancer resistance protein secretes riboflavin (vitamin B2) into milk." Mol Cell Biol. 27(4):1247-1253. PMID:17145775 - [
] Hirai T, et al. (2007) "PPARalpha agonists positively and negatively regulate the expression of several nutrient/drug transporters in mouse small intestine." Biol Pharm Bull. 30(11):2185-2190. PMID:17978498 - [
] de Vries NA, et al. (2007) "P-glycoprotein and breast cancer resistance protein: two dominant transporters working together in limiting the brain penetration of topotecan." Clin Cancer Res. 13(21):6440-6449. PMID:17975156 - [
] Zhang Y, et al. (2007) "Breast cancer resistance protein 1 limits fetal distribution of nitrofurantoin in the pregnant mouse." Drug Metab Dispos. 35(12):2154-2158. PMID:17785426 - [
] Gavrilova O, et al. (2007) "In vivo relevance of Mrp2-mediated biliary excretion of the Amanita mushroom toxin demethylphalloin." Biochim Biophys Acta. 1768(9):2070-2077. PMID:17707334 - [
] de Wolf CJ, et al. (2007) "cGMP transport by vesicles from human and mouse erythrocytes." FEBS J. 274(2):439-450. PMID:17229149 - [
] Takenaka K, et al. (2007) "Substrate overlap between Mrp4 and Abcg2/Bcrp affects purine analogue drug cytotoxicity and tissue distribution." Cancer Res. 67(14):6965-6972. PMID:17638908 - [
] Kalabis GM, et al. (2007) "Breast cancer resistance protein (Bcrp1/Abcg2) in mouse placenta and yolk sac: ontogeny and its regulation by progesterone." Placenta. 28(10):1073-1081. PMID:17524480 - [
] Wang H, et al. (2006) "Expression of the breast cancer resistance protein (Bcrp1/Abcg2) in tissues from pregnant mice: effects of pregnancy and correlations with nuclear receptors." Am J Physiol Endocrinol Metab. 291(6):E1295-E1304. PMID:17082346 - [
] Zong Y, et al. (2006) "Expression of mouse Abcg2 mRNA during hematopoiesis is regulated by alternative use of multiple leader exons and promoters." J Biol Chem. 281(40):29625-29632. PMID:16885162 - [
] Leggas M, et al. (2006) "Gefitinib modulates the function of multiple ATP-binding cassette transporters in vivo." Cancer Res. 66(9):4802-4807. PMID:16651435 - [
] van Herwaarden AE, et al. (2006) "Breast cancer resistance protein (Bcrp1/Abcg2) reduces systemic exposure of the dietary carcinogens aflatoxin B1, IQ and Trp-P-1 but also mediates their secretion into breast milk." Carcinogenesis. 27(1):123-130. PMID:16000399 - [
] Tadjali M, et al. (2006) "Prospective isolation of murine hematopoietic stem cells by expression of an Abcg2/GFP allele." Stem Cells. 24(6):1556-1563. PMID:16484343 - [
] Sawicki WT, et al. (2006) "Temporal/spatial expression and efflux activity of ABC transporter, P-glycoprotein/Abcb1 isoforms and Bcrp/Abcg2 during early murine development." Gene Expr Patterns. 6(7):738-746. PMID:16458078 - [
] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073 - [
] Zhou S, et al. (2005) "Increased expression of the Abcg2 transporter during erythroid maturation plays a role in decreasing cellular protoporphyrin IX levels." Blood. 105(6):2571-2576. PMID:15546952 - [
] Tanaka Y, et al. (2005) "Tissue distribution and hormonal regulation of the breast cancer resistance protein (Bcrp/Abcg2) in rats and mice." Biochem Biophys Res Commun. 326(1):181-187. PMID:15567169 - [
] Jonker JW, et al. (2005) "The breast cancer resistance protein BCRP (ABCG2) concentrates drugs and carcinogenic xenotoxins into milk." Nat Med. 11(2):127-129. PMID:15685169 - [
] Merino G, et al. (2005) "Sex-dependent expression and activity of the ATP-binding cassette transporter breast cancer resistance protein (BCRP/ABCG2) in liver." Mol Pharmacol. 67(5):1765-1771. PMID:15722455 - [
] Breedveld P, et al. (2005) "The effect of Bcrp1 (Abcg2) on the in vivo pharmacokinetics and brain penetration of imatinib mesylate (Gleevec): implications for the use of breast cancer resistance protein and P-glycoprotein inhibitors to enable the brain penetration of imatinib in patients." Cancer Res. 65(7):2577-2582. PMID:15805252 - [
] Jonker JW, et al. (2005) "Contribution of the ABC transporters Bcrp1 and Mdr1a/1b to the side population phenotype in mammary gland and bone marrow of mice." Stem Cells. 23(8):1059-1065. PMID:16002779 - [
] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072 - [
] Krishnamurthy P, et al. (2004) "The stem cell marker Bcrp/ABCG2 enhances hypoxic cell survival through interactions with heme." J Biol Chem. 279(23):24218-24225. PMID:15044468 - [
] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334 - [
] Cisternino S, et al. (2004) "Expression, up-regulation, and transport activity of the multidrug-resistance protein Abcg2 at the mouse blood-brain barrier." Cancer Res. 64(9):3296-3301. PMID:15126373 - [
] Martin CM, et al. (2004) "Persistent expression of the ATP-binding cassette transporter, Abcg2, identifies cardiac SP cells in the developing and adult heart." Dev Biol. 265(1):262-275. PMID:14697368 - [
] Mogi M, et al. (2003) "Akt signaling regulates side population cell phenotype via Bcrp1 translocation." J Biol Chem. 278(40):39068-39075. PMID:12851395 - [
] Easterday MC, et al. (2003) "Neural progenitor genes. Germinal zone expression and analysis of genetic overlap in stem cell populations." Dev Biol. 264(2):309-322. PMID:14651920 - [
] Allen JD, et al. (2003) "Mouse breast cancer resistance protein (Bcrp1/Abcg2) mediates etoposide resistance and transport, but etoposide oral availability is limited primarily by P-glycoprotein." Cancer Res. 63(6):1339-1344. PMID:12649196 - [
] Jonker JW, et al. (2002) "The breast cancer resistance protein protects against a major chlorophyll-derived dietary phototoxin and protoporphyria." Proc Natl Acad Sci U S A. 99(24):15649-15654. PMID:12429862 - [
] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932 - [
] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851 - [
] Zhou S, et al. (2002) "Bcrp1 gene expression is required for normal numbers of side population stem cells in mice, and confers relative protection to mitoxantrone in hematopoietic cells in vivo." Proc Natl Acad Sci U S A. 99(19):12339-12344. PMID:12218177 - [
] Geschwind DH, et al. (2001) "A genetic analysis of neural progenitor differentiation." Neuron. 29(2):325-339. PMID:11239426
An increasingly exploited strategy for the isolation of stem cells is based on the increased efflux of Hoechst 33342 lipophilic dye mediated by ABCG2, an ATP-binding cassette transporter which is highly expressed in various stem cells. We found ABCG2 expression to be present at later stages of spermatogenesis. Western blot analysis using an anti-ABCG2 antibody revealed expression of a 72kDa band in mature sperm obtained from mice, rats, bulls or humans. Immunocytochemistry studies revealed acrosomal staining pattern of ABCG2 in spermatozoa. Experiments using the Hoechst 33342 ABCG2 substrate and the ABCG2-specific inhibitor FTC demonstrated efflux activity of ABCG2 in mature sperm. Incubation of sperm in capacitating medium in the presence of the ABCG2-inhibitor FTC resulted in decreased cholesterol depletion compared to sperm incubated in the absence of FTC. Our results demonstrate that ABCG2 is expressed at the acrosome in mature sperm. ABCG2 may thus serve to mediate cholesterol removal.
Cationic (99m)Tc-agents like (99m)Tc-hexakis-2-methoxyisobutyl isonitrile ((99m)Tc-MIBI) cannot be used for brain imaging because they do not enter the brain as readily as some uncharged (99m)Tc-compounds. The mechanism by which cationic (99m)Tc-agents are transported across the blood-brain barrier (BBB) remains unclear. We explored (99m)Tc-MIBI transport by in situ mouse brain perfusion to determine the influence of BBB features like the ATP-binding cassette transporters (Abcb1/P-glycoprotein (P-gp), Abcc1/Mrp1, and Abcg2/Bcrp), organic cation transporters (Slc22a1-3/Oct1-3), the transmembrane potential and the dipole membrane potential. P-gp reduced (99m)Tc-MIBI transport across the BBB of P-gp-deficient mice 2.2-fold, as confirmed by PSC833 and GF120918 inhibition. Paradoxically verapamil decreased its transport '0.6-fold'. Reducing the BBB dipole membrane potential with tetraphenylborate or phloretin increased (99m)Tc-MIBI transport about 12- and 20-fold, respectively. Guanidine, diphenhydramine, and carnitine significantly decreased (99m)Tc-MIBI transport, but tetraethylammonium did not. (99m)Tc-MIBI transport at the BBB is restricted by P-gp but not by Mrp1 or Bcrp. Some organic cations reduced the influx of (99m)Tc-MIBI into the brain independently of Oct1, 2 and 3, but this could be due to their effect on another cation transporter. The membrane dipole potential of the luminal BBB membrane appeared to be the main factor restricting (99m)Tc-MIBI permeability.
In normal brain, the side population (SP) phenotype is generated by ABC transporter activity and identifies stem cell and endothelial cell subpopulations by dye exclusion. By drug efflux, the ABCG2 transporter provides chemoresistance in stem cells and contributes to the blood brain barrier (BBB) when active in endothelial cells. We investigated the SP phenotype of mouse and human gliomas. In glioma endothelial cells, ABC transporter function is impaired, corresponding to disruption of the BBB in these tumors. By contrast, the SP phenotype is increased in nonendothelial cells that form neurospheres and are highly tumorigenic. In this cell population, Akt, but not its downstream target mTOR, regulates ABCG2 activity, and loss of PTEN increases the SP. This Akt-induced ABCG2 activation results from its transport to the plasma membrane. Temozolomide, the standard treatment of gliomas, although not an ABCG2 substrate, increases the SP in glioma cells, especially in cells missing PTEN.
PURPOSE: To evaluate the in vivo efficacy of curcumin as an inhibitor of the multidrug-resistance-linked ATP Binding Cassette (ABC) drug transporter, ABCG2. METHODS: Photoaffinity labeling with [125I]-iodoarylazidoprazosin was used to characterize the interaction of sulfasalazine, a substrate of the mouse ABCG2, with human ABCG2. In addition, the inhibitory effect of curcumin on ABCG2 was evaluated in brain capillaries from rats. Furthermore, the effect of curcumin on absorption of orally administered sulfasalazine in wild-type and abcg2-/- mice was also determined. RESULTS: Sulfasalazine interacted at the drug-substrate site(s) of human ABCG2. Curcumin inhibited ABCG2 activity at nanomolar concentrations at the rat blood-brain barrier in the ex vivo assay. Based on studies in wild type and abcg2-/- mice, we observed that oral curcumin increased Cmax and relative bioavailability of sulfasalazine by selectively inhibiting ABCG2 function. CONCLUSIONS: This study validates our previous in vitro results with human ABCG2 (Chearwae et al., Mol. Cancer Ther. 5:1995-2006, 2006) and provides the first in vivo evidence for the inhibition by curcumin of ABCG2-mediated efflux of sulfasalazine in mice. Based on these studies, we propose that non-toxic concentrations of curcumin may be used to enhance drug exposure when the rate-limiting step of drug absorption and/or tissue distribution is impacted by ABCG2.
Breast cancer resistance protein (BCRP) is most abundantly expressed in the apical membrane of placental syncytiotrophoblasts, suggesting that it may protect the fetus by impeding drug penetration across the placental barrier. Glyburide (GLB) is an antidiabetic drug routinely used to treat gestational diabetes. In this study, we first determined whether GLB is a BCRP/Bcrp1 substrate. The intracellular [(3)H]GLB concentrations in Madin-Darby canine kidney (MDCK)/BCRP cells were significantly lower than those in MDCK/vector cells. The addition of 10 muM fumitremorgin C, a specific BCRP inhibitor, significantly increased the intracellular [(3)H]GLB concentrations approximately 2-fold in MDCK/BCRP cells, but it had no effect in MDCK/vector cells. Similar results were obtained using MDCKII parent and MDCKII/Bcrp1 cells. GLB was also shown to be a BCRP/Bcrp1 substrate in transwell transport experiments. We then examined whether Bcrp1 limits fetal distribution of GLB in the pregnant mouse. GLB was administered by retro-orbital injection to the wild-type and Bcrp1(-/-) pregnant mice. The maternal plasma samples and fetuses were collected at various times (0.5-240 min) after drug administration. The GLB concentrations in the maternal plasma samples and homogenates of fetal tissues were determined by high-performance liquid chromatography/mass spectrometry. Although the maternal plasma area under the concentration-time curves (AUCs) of GLB in the wild-type and Bcrp1(-/-) pregnant mice were comparable, the fetal AUC of GLB in the Bcrp1(-/-) pregnant mice was approximately 2 times greater than that in the wild-type pregnant mice. These results suggest that GLB is a BCRP/Bcrp1 substrate, and Bcrp1 significantly limits fetal distribution of GLB in the pregnant mouse, but it has only a minor effect on the systemic clearance of the drug.
The submandibular gland (SMG) is a tissue that can be regenerated in a tissue injury model and that has adult stem cells capable of self-renewal and differentiation into functional cells. We have analyzed the localization of label-retaining cells (LRCs), which are putative progenitor cells, by using the BrdU-labeling method. 5-Bromo-2'-deoxyuridine (BrdU) injection followed by a long chasing period permitted the identification of LRCs based on the slow-cycling characteristic. In order to confirm the accurate localization of LRCs, BrdU and SMG-specific markers, including aquaporin5, cytokeratin, and smooth muscle actin, were examined by double-immunofluorescence staining. We found that LRCs were distributed in the acinus, duct, myoepithelium, and connective tissue. Moreover, ABCG2 (a known stem cell marker) was used for the characterization of LRCs and the localization of cells as putative stem/progenitor cells. ABCG2-expressing cells were distributed in various regions of the SMG but did not co-localize with LRCs. We suggest that putative progenitor cells exist in various regions of the SMG and have diverse capacities to differentiate into specific cells.
BACKGROUND: Under appropriate culture conditions, undifferentiated embryonic stem (ES) cells can undergo multiple self-renewal cycles without loss of pluripotency suggesting they must be equipped with specific defense mechanisms to ensure sufficient genetic stability during self-renewal expansion. The ATP binding cassette transporter ABCG2 is expressed in a wide variety of somatic and embryonic stem cells. However, whether it plays an important role in stem cell maintenance remains to be defined. METHODOLOGY/PRINCIPAL FINDINGS: Here we provide evidence to show that an increase in the level of ABCG2 was observed accompanied by ES colony expansion and then were followed by decreases in the level of protoporphyrin IX (PPIX) indicating that ABCG2 plays a role in maintaining porphyrin homoeostasis. RNA-interference mediated inhibition of ABCG2 as well as functional blockage of ABCG2 transporter with fumitremorgin C (FTC), a specific and potent inhibitor of ABCG2, not only elevated the cellular level of PPIX, but also arrest the cell cycle and reduced expression of the pluripotent gene Nanog. Overexpression of ABCG2 in ES cells was able to counteract the increase of endogenous PPIX induced by treatment with 5-Aminolevulinic acid suggesting ABCG2 played a direct role in removal of PPIX from ES cells. We also found that excess PPIX in ES cells led to elevated levels of reactive oxygen species which in turn triggered DNA damage signals as indicated by increased levels of gammaH2AX and phosphorylated p53. The increased level of p53 reduced Nanog expression because RNA- interference mediated inhibition of p53 was able to prevent the downregulation of Nanog induced by FTC treatment. CONCLUSIONS/SIGNIFICANCE: The present work demonstrated that ABCG2 protects ES cells from PPIX accumulation during colony expansion, and that p53 and gammaH2AX acts as a downstream checkpoint of ABCG2-dependent defense machinery in order to maintain the self-renewal of ES cells.
Recently, the side population (SP) phenotype has been introduced as a reliable marker to identify subpopulations of cells with stem/progenitor cell properties in various tissues. We and others have identified SP cells from postmitotic tissues, including adult myocardium, in which they have been suggested to contribute to cellular regeneration following injury. SP cells are identified and characterized by a unique efflux of Hoechst 33342 dye. Abcg2 belongs to the ATP-binding cassette (ABC) transporter superfamily and constitutes the molecular basis for the dye efflux, hence the SP phenotype, in hematopoietic stem cells. Although Abcg2 is also expressed in cardiac SP (cSP) cells, its role in regulating the SP phenotype and function of cSP cells is unknown. Herein, we demonstrate that regulation of the SP phenotype in cSP cells occurs in a dynamic, age-dependent fashion, with Abcg2 as the molecular determinant of the cSP phenotype in the neonatal heart and another ABC transporter, Mdr1, as the main contributor to the SP phenotype in the adult heart. Using loss- and gain-of-function experiments, we find that Abcg2 tightly regulates cell fate and function. Adult cSP cells isolated from mice with genetic ablation of Abcg2 exhibit blunted proliferation capacity and augmented cell death. Conversely, overexpression of Abcg2 is sufficient to enhance cell proliferation, although with a limitation of cardiomyogenic differentiation. In summary, for the first time, we reveal a functional role for Abcg2 in modulating the proliferation, differentiation, and survival of adult cSP cells that goes beyond its distinct role in Hoechst dye efflux.
PURPOSE: In vitro assessment of drug candidates' affinity for multi-drug resistance proteins is of crucial importance for the prediction of in vivo pharmacokinetics and drug-drug interactions. To have well described experimental tools at hand, the objective of the study was to characterize substrates and inhibitors of Breast Cancer Resistance Protein (BCRP) and P-glycoprotein (P-gp). METHODS: Madin-Darbin canine kidney cells overexpressing mouse Bcrp (MDCKII-Bcrp) were incubated with various Bcrp substrates, or a mixture of substrate and inhibitor to either the apical (A) or basolateral (B) compartment of insert filter plates. Substrate concentrations in both compartments at time points t = 0 h and t = 2 h were determined by LC-MS/MS, and respective permeation coefficients (Papp) and efflux ratios were calculated. RESULTS: The Bcrp inhibitor Ko143 blocked topotecan and ABZSO transport in a concentration-dependent manner. P-gp inhibitors ivermectin, LY335979, PSC833, and the P-gp/Bcrp inhibitor ritonavir did not influence Bcrp mediated topotecan transport, however, blocked ABZSO transport. Additionally, neither was ABZSO transport influenced by topotecan, nor topotecan transport by ABZSO. CONCLUSIONS: Data suggest different modes of substrate and inhibitor binding to Bcrp. In order to not overlook potential drug-drug interactions when testing drug candidates for inhibitory potential towards Bcrp, distinct Bcrp probe substrates should be used.
Stem and progenitor cell populations occupy a specialized niche and are consequently exposed to hypoxic as well as oxidative stresses. We have previously established that the multidrug resistance protein Abcg2 is the molecular determinant of the side population (SP) progenitor cell population. We observed that the cardiac SP cells increase in number more than 3-fold within 3 days of injury. Transcriptome analysis of the SP cells isolated from the injured adult murine heart reveals increased expression of cytoprotective transcripts. Overexpression of Abcg2 results in an increased ability to consume hydrogen peroxide and is associated with increased levels of alpha-glutathione reductase protein expression. Importantly, overexpression of Abcg2 also conferred a cell survival benefit following exposure to hydrogen peroxide. To further examine the molecular regulation of the Abcg2 gene, we demonstrated that hypoxia-inducible factor (HIF)-2alpha binds an evolutionary conserved HIF-2alpha response element in the murine Abcg2 promoter. Transcriptional assays reveal a dose-dependent activation of Abcg2 expression by HIF-2alpha. These results support the hypothesis that Abcg2 is a direct downstream target of HIF-2alpha which functions with other factors to initiate a cytoprotective program for this progenitor SP cell population that resides in the adult heart.
The majority of chronic phase chronic myeloid leukemia (CML) patients treated with the tyrosine kinase inhibitor (TKI) imatinib mesylate maintain durable responses to the drug. However, most patients relapse after withdrawal of imatinib and advanced stage patients often develop drug resistance. As CML is considered a hematopoietic stem cell cancer, it has been postulated that inherent protective mechanisms lead to relapse in patients. The ATP binding-cassette transporters ABCB1 (MDR-1; P-glycoprotein) and ABCG2 are highly expressed on primitive hematopoietic stem cells (HSCs) and have been shown to interact with TKIs. Herein we demonstrate a dose-dependent, reversible inhibition of ABCG2-mediated Hoechst 33342 dye efflux in primary human and murine HSC by both imatinib and nilotinib (AMN107), a novel aminopyrimidine inhibitor of BCR-ABL. ABCG2-transduced K562 cells were protected from imatinib and nilotinib-mediated cell death and from downregulation of P-CRKL. Moreover, photoaffinity labeling revealed interaction of both TKIs with ABCG2 at the substrate binding sites as they compete with the binding of [(125)I] IAAP and also stimulate the transporter's ATPase activity. Therefore, our evidence suggests for the role of ABC transporters in resistance to TKI on primitive HSCs and CML stem cells and provides a rationale how TKI resistance can be overcome in vivo.
Recently, breast cancer resistance protein (BCRP/ABCG2) has been shown to limit the oral absorption of its substrates in the intestine. The purpose of this study was to examine whether excipients can be used as inhibitors of BCRP, to improve the oral drug absorption of BCRP substrates. In wild-type mice, Pluronic P85 and Tween 20, given orally 15 min before topotecan administration, increased the area under the plasma concentration-time curve (AUC) of topotecan after oral administration (2.0- and 1.8-fold, respectively). In contrast, Pluronic P85 and Tween 20 were less effective (no significant difference) on the AUC of topotecan after oral administration in Bcrp (-/-) mice (1.2- and 1.2-fold, respectively). Pluronic P85 and Tween 20 given orally did not affect significantly the AUC of topotecan after intravenous administration in wild-type and Bcrp (-/-) mice. Moreover, we determined the mucosal-to-serosal absorptive transport of topotecan using everted mouse ileum. Pluronic P85 and Tween 20 significantly increased the intestinal absorption rate of topotecan in everted sacs from wild-type mice whereas, in everted sacs from Bcrp (-/-) mice, the absorption rate was 2.1-fold greater than that in wild-type mice, and these excipients were not significantly effective. There was no significant difference in the intestinal P-glycoprotein (P-gp) expression and serosal-to-mucosal secretory transport of rhodamine 123, a typical P-gp substrate. Taken together, these results suggest that Pluronic P85 and Tween 20 can improve the oral bioavailability of BCRP substrates by inhibiting BCRP function in the small intestine.
The bioavailability and targeted distribution of abacavir (ABC) and zidovudine (AZT) to viral reservoirs may be influenced by efflux transporters. The purpose of this study was to characterize the interaction of these nucleoside reverse transcriptase inhibitors with the Abcg2/Bcrp1 transporter, the murine homolog of human breast cancer resistance protein (BCRP), using a Bcrp1-transfected Madin-Darby canine kidney II cell model. Intracellular accumulation of ABC and AZT was significantly reduced by approximately 90% and approximately 70%, respectively, in Bcrp1-transfected cells compared with the wild-type cells. Both ABC and AZT showed significantly increased basolateral-to-apical (B-to-A) and decreased apical-to-basolateral (A-to-B) transport in Bcrp1 cells compared with wild-type directional flux. The efflux ratio (ratio of B-to-A to A-to-B) in Bcrp1-transfected cells was 22 for ABC and 11 for AZT. N-(4-[2-(1,2,3,4-tetrahydro-6,7-dimethoxy-2-isoquinolinyl)ethyl]-phenyl)-9,10-dih ydro-5-methoxy-9-oxo-4-acridine carboxamide (GF120918) inhibited this difference in accumulation between the two cell variants with an EC(50) of 1.32 +/- 0.3 microM for ABC and 0.31 +/- 0.1 microM for AZT. Potent and highly cooperative inhibition by Ko143 (3-(6-isobutyl-9-methoxy-1,4-dioxo-1,2,3,4,6,7,12,12a-octahydropyrazino[1',2':1,6 ]pyrido[3,4-b]indol-3-yl)-propionic acid tert-butyl ester) was observed with an EC(50) of 121 +/- 5 nM for ABC and 19.2 +/- 1.5 nM for AZT (Hill coefficient approximately 3-6). Probenecid, an organic anion inhibitor known to influence AZT biodistribution, had no effect on cellular accumulation in the Bcrp1 model. These studies characterize the Bcrp1-mediated transport of ABC and AZT and show that prototypical BCRP inhibitors GF120918 and Ko143 can inhibit the Bcrp1-mediated transport of these important antiretroviral compounds. The functional expression of BCRP at critical barriers, such as the intestinal enterocytes, brain capillary endothelium, and target lymphocytes, could influence the bioavailability and targeted delivery of these drugs to sanctuary sites.
Proper regulation of intracellular levels of protoporphyrin IX (PPIX), the direct precursor of heme, is important for cell survival. A deficiency in ferrochelatase, which mediates the final step in heme biosynthesis, leads to erythropoietic protoporphyria (EPP), a photosensitivity syndrome caused by the accumulation of PPIX in the skin. We have previously shown that mice with a deficiency in the ABC transporter Bcrp1/Abcg2 display a novel type of protoporphyria. This protoporphyria is mild compared with ferrochelatase-dependent EPP, and in itself not sufficient to cause phototoxicity, but it might exacerbate the consequences of other porphyrias. In this study, we identified the mouse harderian gland as a novel expression site of Bcrp1. Because of its pronounced role in porphyrin secretion, the harderian gland presents a useful tool to study the mechanism of Bcrp1-related protoporphyria and transport of porphyrins. Bcrp1(-/-) harderian gland displayed a highly increased accumulation of PPIX glycoconjugates, and a similar shift was seen in Bcrp1(-/-) liver. Tear- and hepatobiliary excretion data suggest that Bcrp1 controls intracellular levels of PPIX by mediating high affinity transport of its glycoconjugates and possibly low-affinity transport of unconjugated PPIX. This mechanism may allow cells to prevent or reduce cytotoxicity of PPIX under excess conditions, without spillage under physiological conditions where PPIX is needed.
Imatinib, a protein tyrosine kinase inhibitor, may prevent the growth of glioblastoma cells. Unfortunately, its brain distribution is restricted by p-glycoprotein (p-gp or multidrug resistance protein Mdr1a), and probably by breast cancer resistance protein (Bcrp1), two efflux pumps expressed at the blood-brain barrier (BBB). We have used in situ brain perfusion to investigate the mechanisms of imatinib transport across the mouse BBB. The brain uptake of imatinib in wild-type mice was limited by saturable efflux processes. The inhibition of p-gp, by valspodar and zosuquidar, increased imatinib uptake (2.5-fold), as did the deficiency of p-gp in Mdr1a/1b(-/-) mice (5.5-fold). Perfusing imatinib with the p-gp/Bcrp1 inhibitor, elacridar, enhanced the brain uptake of imatinib in wild-type (4.1-fold) and Mdr1a/1b(-/-) mice (1.2-fold). However, the brain uptake of imatinib was similar in wild-type and Bcrp1(-/-) mice when it was perfused at a non-saturating concentration. The brain uptake of CGP74588, an active metabolite of imatinib, was low. It was increased by perfusion with elacridar (twofold), but not with valspodar and zosuquidar. CGP74588 uptake was 1.5 times greater in Bcrp1(-/-) mice than in wild-type mice. These data suggest that imatinib transport at the mouse BBB is limited by p-gp and probably by Bcrp1, and that CGP74588 transport is restricted by Bcrp1.
The role of ATP-binding cassette transporters in the urinary excretion of diuretics was investigated. Significant ATP-dependent uptake of hydrochlorothiazide (HCT) and furosemide was observed in membrane vesicles that expressed multidrug resistance-associated protein 4 (MRP4) and breast cancer resistance protein (BCRP). Unlike taurocholate uptake, S-methylglutathione had no effect on the ATP-dependent uptake of both compounds by MRP4. The functional importance of MRP4 and BCRP in the urinary excretion of HCT and furosemide was investigated using gene knockout mice. The renal clearance of HCT and furosemide was reduced significantly but not abolished in Mrp4 knockout mice compared with wild-type mice (9.0 +/- 0.9 versus 15 +/- 2 ml/min per kg for HCT and 1.9 +/- 0.3 versus 2.7 +/- 0.1 ml/min per kg for furosemide), and the amount of HCT that was associated with the kidney specimens was greater in Mrp4 knockout mice (21 +/- 3 versus 13 +/- 1 nmol/g kidney). In contrast, Bcrp makes only a negligible contribution because the urinary excretion was unchanged in Bcrp knockout mice. Our results suggest that Mrp4, together with other unknown transporters, accounts for the luminal efflux of HCT and furosemide from proximal tubular epithelial cells.
The multidrug transporter breast cancer resistance protein (BCRP/ABCG2) is strongly induced in the mammary gland during pregnancy and lactation. We here demonstrate that BCRP is responsible for pumping riboflavin (vitamin B(2)) into milk, thus supplying the young with this important nutrient. In Bcrp1(-/-) mice, milk secretion of riboflavin was reduced >60-fold compared to that in wild-type mice. Yet, under laboratory conditions, Bcrp1(-/-) pups showed no riboflavin deficiency due to concomitant milk secretion of its cofactor flavin adenine dinucleotide, which was not affected. Thus, two independent secretion mechanisms supply vitamin B(2) equivalents to milk. BCRP is the first active riboflavin efflux transporter identified in mammals and the first transporter shown to concentrate a vitamin into milk. BCRP activity elsewhere in the body protects against xenotoxins by reducing their absorption and mediating their excretion. Indeed, Bcrp1 activity increased excretion of riboflavin into the intestine and decreased its systemic availability in adult mice. Surprisingly, the paradoxical dual utilization of BCRP as a xenotoxin and a riboflavin pump is evolutionarily conserved among mammals as diverse as mice and humans. This study establishes the principle that an ABC transporter can transport a vitamin into milk and raises the possibility that other vitamins and nutrients are likewise secreted into milk by ABC transporters.
A systematic analysis to examine the effects of peroxisome proliferator-activated receptor (PPAR)alpha agonists on the expression levels of all the nutrient/drug plasma-membrane transporters in the mouse small intestine was performed. Transporter mRNAs that were induced or repressed by two independent PPARalpha-specific agonists were identified by a genome-wide microarray method, and the changes were confirmed by real-time PCR using RNA isolated from the intestines and livers of wild-type and PPARalpha-null mice. Expression levels of seven nutrient/drug transporters (Abcd3, Octn2/Slc22a5, FATP2/Slc27a2, Slc22a21, Mct13/Slc16a13, Slc23a1 and Bcrp/Abcg2) in the intestine were up-regulated and the expression level of one (Mrp1/Abcc1) was down-regulated by PPARalpha; although the previously report that the H(+)/peptide co-transporter 1 (Pept1) is up-regulated by PPARalpha was not replicated in our study. We propose that the transport processes can be coordinately regulated with intracellular metabolism by nutrient nuclear receptors.
PURPOSE: The brain is a pharmacologic sanctuary site, due to the presence of the blood-brain barrier (BBB). Whereas the effect of P-glycoprotein (P-gp) at the BBB is well established, the role of breast cancer resistance protein (BCRP) that is also expressed at the BBB is not. EXPERIMENTAL DESIGN: We have studied the effect of BCRP by administering topotecan to wild-type (WT), single Mdr1a/b(-/-) and Bcrp1(-/-), and compound Mdr1a/b(-/-)Bcrp1(-/-) knockout mice. Drug levels in plasma and tissues were determined by high-performance liquid chromatography. RESULTS: The area under the plasma and tissue concentration-time curve (AUC) of topotecan in brains of Mdr1a/b(-/-) and Bcrp1(-/-) mice was only 1.5-fold higher compared with WT mice, but in Mdr1a/b(-/-)Bcrp1(-/-) mice, where both transporters are absent, the AUC increased by 12-fold. The AUC in plasma was approximately 0.75-, 2.4-, and 3.7-fold higher in Mdr1a/b(-/-), Bcrp1(-/-), and Mdr1a/b(-/-)Bcrp1(-/-) mice, respectively, resulting in 2.0-fold (P < 0.01), 0.65-fold (P, not significant), and 3.2-fold (P < 0.01), respectively, higher brain-to-plasma AUC ratios. Results using Mrp4(-/-) mice showed that this transporter had no effect on the brain penetration of topotecan. The P-gp/BCRP inhibitor elacridar fully inhibited P-gp-mediated transport of topotecan, whereas inhibition of Bcrp1-mediated transport by elacridar was minimal. CONCLUSIONS: Our results using Mdr1a/b(-/-)Bcrp1(-/-) mice clearly show the effect of Bcrp1 at the BBB and also show how two drug transporters act in concert to limit the brain penetration of topotecan. We expect that this finding will also apply to other drugs that are substrates of both P-gp and BCRP. Consequently, to improve the brain penetration of such compounds for targeting intracranial malignancies in patients, it will be essential to use potent inhibitors of both drug transporters.
The efflux transporter, the breast cancer resistance protein (BCRP), is most abundantly expressed in the apical membrane of the placental syncytiotrophoblasts, indicating that it could play an important role in protecting the fetus by limiting xenobiotic/drug penetration across the placental barrier. In the present study, we examined whether Bcrp1, the murine homolog of human BCRP, limits fetal distribution of the model BCRP/Bcrp1 substrate, nitrofurantoin (NFT), in the pregnant mouse. NFT was administered i.v. to FVB wild-type and Bcrp1(-/-) pregnant mice. The maternal plasma samples and fetuses were collected at various times (5-60 min) after drug administration. The NFT concentrations in the maternal plasma samples and homogenates of fetal tissues were determined by a high-performance liquid chromatography/UV assay. Although the maternal plasma area under the concentration-time curve (AUC) of NFT in the Bcrp1(-/-) pregnant mice (97.4 +/- 10.0 microg . min/ml plasma) was only slightly (but significantly) higher than that in the wild-type pregnant mice (78.4 +/- 6.0 microg . min/ml plasma), the fetal AUC of NFT in the Bcrp1(-/-) pregnant mice (1493.0 +/- 235.3 ng . min/g of fetus) was approximately 5 times greater than that in the wild-type pregnant mice (298.6 +/- 77.4 ng . min/g of fetus). These results clearly suggest that Bcrp1 significantly limits fetal distribution of NFT in the pregnant mouse, but has only a minor effect on the systemic clearance of the drug.
To determine which efflux carriers are involved in hepatic phalloidin elimination, hepatobiliary [(3)H]-demethylphalloin (DMP) excretion was studied in normal Wistar rats and in Mrp2 deficient TR(-) Wistar rats as well as in normal wild-type FVB mice, Mdr1a,b(-/-) knockout mice, and Bcrp1(-/-) knockout mice by in situ bile duct/gallbladder cannulation. A subtoxic dose of 0.03 mg DMP/kg b.w. was used, which did not induce cholestasis in any tested animal. Excretion of DMP into bile was not altered in Mdr1a,b(-/-) mice or in Bcrp1(-/-) mice compared with wild-type FVB mice. Whereas 17.6% of the applied dose was excreted into bile of normal Wistar rats, hepatobiliary excretion decreased to 7.9% in TR(-) rats within 2 h after intravenous application. This decrease was not due to reduced cellular DMP uptake, as shown by normal expression of Oatp1b2 in livers of TR(-) rats and functional DMP uptake into isolated TR(-) rat hepatocytes. Tissue concentrations of phalloidin were also not altered in any of the transgenic mice. Interestingly, the decrease of biliary DMP excretion in the TR(-) rats was not followed by any increase of phalloidin accumulation in the liver but yielded a compensatory excretion of the toxin into urine, indicating that hepatocytes of TR(-) rats expelled phalloidin back into blood circulation.
cGMP secretion from cells can be mediated by ATP-binding cassette (ABC) transporters ABCC4, ABCC5, and ABCC11. Indirect evidence suggests that ABCC4 and ABCC5 contribute to cGMP transport by erythrocytes. We have re-investigated the issue using erythrocytes from wild-type and transporter knockout mice. Murine wild-type erythrocyte vesicles transported cGMP with an apparent Km that was 100-fold higher than their human counterparts, the apparent Vmax being similar. Whereas cGMP transport into human vesicles was efficiently inhibited by the ABCC4-specific substrate prostaglandin E1, cGMP transport into mouse vesicles was inhibited equally by Abcg2 and Abcc4 inhibitors/substrates. Similarly, cGMP transport into vesicles from Abcc4-/- and Abcg2-/- mice was 42% and 51% of that into wild-type mouse vesicles, respectively, whereas cGMP transport into vesicles from Abcc4(-/-)/Abcg2(-/-) mice was near background. The knockout mice were used to show that Abcg2-mediated cGMP transport occurred with lower affinity but higher Vmax than Abcc4-mediated transport. Involvement of Abcg2 in cGMP transport by Abcc4-/- erythrocyte vesicles was supported by higher transport at pH 5.5 than at pH 7.4, a characteristic of Abcg2-mediated transport. The relative contribution of ABCC4/Abcc4 and ABCG2/Abcg2 in cGMP transport was confirmed with a new inhibitor of ABCC4 transport, the protease inhibitor 4-(2-aminoethyl)benzenesulfonyl fluoride.
The use of probe substrates and combinations of ATP-binding cassette (ABC) transporter knockout (KO) animals may facilitate the identification of common substrates between apparently unrelated ABC transporters. An unexpectedly low concentration of the purine nucleotide analogue, 9-(2-(phosphonomethoxy)ethyl)-adenine (PMEA), and up-regulation of Abcg2 in some tissues of the Mrp4 KO mouse prompted us to evaluate the possibility that Abcg2 might transport purine-derived drugs. Abcg2 transported and conferred resistance to PMEA. Moreover, a specific Abcg2 inhibitor, fumitremorgin C, both increased PMEA accumulation and reversed Abcg2-mediated PMEA resistance. We developed Mrp4 and Abcg2 double KO mice and used both single KOs of Abcg2 and Mrp4 mice to assess the role of these transporters in vivo. Abcg2 contributed to PMEA accumulation in a variety of tissues, but in some tissues, this contribution was only revealed by the concurrent absence of Mrp4. Abcg2 also transported and conferred resistance to additional purine analogues, such as the antineoplastic, 2-chloro-2'-deoxyadenosine (cladribine) and puromycin, a protein synthesis inhibitor that is often used as a dominant selectable marker. Purine analogues interact with ABCG2 by a site distinct from the prazosin binding site as shown by their inability to displace the substrate analogue and photoaffinity tag [(125)I]iodoarylazidoprazosin. These studies show that Abcg2, like Mrp4, transports and confers resistance to purine nucleoside analogues and suggest that these two transporters work in parallel to affect drug cytotoxicity and tissue distribution. This new knowledge will facilitate an understanding of how Abcg2 and Mrp4, separately and in combination, protect against purine analogue host toxicity as well as resistance to chemotherapy.
Breast Cancer Resistance Protein (BCRP), a recently-discovered transporter belonging to ABC superfamily, is highly expressed within the labyrinth of the placenta, the primary site of exchange between the maternal and fetal circulation. It has been proposed to function as an efflux pump protecting the fetus from a wide range of xenobiotics. It has also been recently shown that the yolk sac, in addition to the placenta, may be involved in transport of certain substances to and from the fetus. We hypothesised that there are changes in placental Bcrp1 (the mouse orthologue of human BCRP) expression during pregnancy and that these correlate with changes in progesterone production that occur in late gestation. We also hypothesised that Bcrp1 is expressed in the yolk sac, and that levels change with advancing gestation. Either whole concepti, or placenta and yolk sac, were collected from pregnant mice and analysed at embryonic (E) day 9.5, 12.5, 15.5 and 18.5 (term approximately E19.5). Peak expression of Bcrp1 mRNA was detected using in situ hybridisation within the placenta at E9.5 and the yolk sac at E12.5. There was a significant decrease thereafter in both tissues (p<0.001). In contrast, expression of Bcrp1 protein as assessed by immunohistochemistry and Western immunoblots did not change significantly during gestation either in the placenta nor the yolk sac, and no sex difference in Bcrp1 protein expression in either tissue was observed at E12.5. Daily progesterone treatment starting at E14.5 and continuing until E18.5 significantly increased maternal progesterone levels, but did not elicit any changes in the Bcrp1 mRNA or Bcrp1 protein expression either in the placenta or the yolk sac. Significant expression of Bcrp1 protein in fetal tissue was evident at the end of gestation, while expression in the fetal brain endothelium was evident as early as E12.5. We suggest that the placenta and the yolk sac, both of which express Bcrp1, may limit fetal exposure to the potentially adverse effects of xenobiotics including therapeutic drugs which the mother may be exposed to during pregnancy. The significant decrease in Bcrp1 mRNA expression in both the yolk sac and the placenta from mid to late gestation may be counter-balanced by an increase in Bcrp1 expression in fetal organs involved in absorption, excretion and protection.
The breast cancer resistance protein (BCRP) plays an important role in drug disposition, including limiting drug penetration across the placental barrier. Our goal was to investigate the effects of pregnancy on Bcrp1 expression in pregnant mice. We examined Bcrp1 expression in placenta, kidney, liver, and small intestine at various gestational ages. Bcrp1 protein levels peaked at gestation day (gd) 15 in placenta, at gd 10 and 15 in kidney, and at gd 15 in liver; however, Bcrp1 protein levels in small intestine did not change significantly with gestational ages. Immunohistochemistry analysis revealed that the cellular localization of Bcrp1 in placenta, kidney, liver, and small intestine was not influenced by pregnancy. Bcrp1 mRNA levels were analyzed by quantitative real-time RT-PCR. In general, the effects of pregnancy on Bcrp1 protein somewhat lagged behind the effects on Bcrp1 mRNA. To further investigate the possible roles of nuclear receptors in the regulation of the Bcrp1 gene during pregnancy, we examined mRNA levels of aryl hydrocarbon receptor (AhR), hypoxia-inducible factor 1alpha (HIF1alpha), estrogen receptor alpha (ERalpha), estrogen receptor beta (ERbeta), or progesterone receptor and compared them with those of Bcrp1. Bcrp1 mRNA was significantly correlated with mRNA of AhR, HIF1alpha, and ERbeta in placenta, with mRNA of HIF1alpha in kidney, and with mRNA of AhR and ERalpha in liver. These data suggest that Bcrp1 expression in mouse tissues can be altered by pregnancy in a gestational age-dependent manner. Such effects are likely mediated by certain nuclear receptors through a transcriptional mechanism.
ABCG2 encodes a transmembrane transporter associated with multidrug resistance in various cancer cells. ABCG2 is also highly expressed in hematopoietic stem cells (HSCs) and is down-regulated in most committed progenitors, whereas expression is sharply up-regulated during erythroid differentiation. The mechanisms for regulation of ABCG2 expression in hematopoietic cells are poorly understood. We have recently identified three novel leader exons (termed E1A, E1B, and E1C) located in the 5'-untranslated region of mouse Abcg2 mRNA by data base searches and reverse transcription-PCR. In a mouse erythroid cell line, reverse transcription-PCR analysis showed that the transcript containing E1B exon was the only isoform detected. Consistently, the E1B-containing transcript was the predominant isoform of Abcg2 mRNA in primary Ter119+ erythroid cells from mouse bone marrow as well as in mouse fetal liver cells. In contrast, the E1A-containing transcript was highly expressed in c-Kit+, Sca-1+, Lin- (KSL) bone marrow cells, especially in CD34- KSL fraction, which is highly enriched for repopulating HSCs. The differential expression pattern of Abcg2 mRNA isoforms in mouse HSCs and erythroid cells was confirmed by 5'-rapid amplification of cDNA ends, indicating that at least two different promoters control mouse Abcg2 transcription during hematopoiesis. Promoter functional assays using EGFP as reporter gene demonstrated that the E1A 5'-flanking region had promoter activity, which contains multiple putative hematopoietic transcription factor binding sites. In summary, our data show that the expression of Abcg2 during hematopoiesis is transcriptionally regulated by alternative use of multiple leader exons and promoters in a developmental stage-specific manner.
The 4-anilinoquinazoline (4-AQ) derivative gefitinib (Iressa) is an oral epidermal growth factor receptor tyrosine kinase inhibitor. Oral administration of 4-AQ molecules, such as gefitinib, inhibits ATP-binding cassette (ABC) transporter-mediated drug efflux and strongly increases the apparent bioavailability of coadministered drug molecules that are transporter substrates. Based on in vitro studies investigating 4-AQ interactions with several transporters, these effects have primarily been attributed to the inhibition of breast cancer resistance protein (BCRP; ABCG2). Although 4-AQ shows in vitro inhibition of P-glycoprotein [multidrug resistance protein (MDR1); ABCB1], the in vivo effect on this and other transporters is not known. In our studies, pretreatment of Abcg2(-/-) and Mdr1(a/b)(-/-) mice with gefitinib increased oral absorption and decreased systemic clearance of topotecan, a model substrate, indicating that additional transporters were inhibited. These results were extended to human orthologues using engineered cell lines to show that gefitinib inhibited the efflux of BCRP and MDR1 substrates and restored vincristine sensitivity in MDR1-expressing cells. Although gefitinib inhibited BCRP more potently than MDR1 (10-fold), the inhibition of both transporters occurred at clinically relevant concentrations (e.g., 1-5 micromol/L). These studies illustrate the broad implications for the therapeutic combination of gefitinib or other 4-AQ molecules with agents that are BCRP and MDR1 substrates. 4-AQ molecules may offer a means to increase the low and variable oral drug absorption of transporter substrates while decreasing interpatient variability and reversing tumor drug resistance.
The breast cancer resistance protein (BCRP/ABCG2) usually protects the body from a wide variety of environmental and dietary xenotoxins by reducing their net uptake from intestine and by increasing their hepatobiliary, intestinal and renal elimination. BCRP is also highly expressed in lactating mammary glands in mice, and this expression is conserved in cows and humans. As a result, BCRP substrates can be secreted into milk. We investigated whether different classes of dietary carcinogens are substrates of Bcrp1/BCRP and the implications for systemic exposure and breast milk contamination. Using polarized cell lines, we found that Bcrp1 transports the heterocyclic amines 2-amino-3-methylimidazo[4,5-f]quinoline (IQ) and 3-amino-1,4-dimethyl-5H-pyrido[4,3-b]indole (Trp-P-1) and the potent human hepatocarcinogen aflatoxin B1, and decreases their cellular accumulation up to 10-fold. In vivo pharmacokinetic studies showed that [14C]IQ, [14C]Trp-P-1 and [3H]aflatoxin B1 plasma levels were substantially lower in wild-type compared with Bcrp1-/- mice, after both oral and intravenous administration, demonstrating that Bcrp1 restricts systemic exposure to these carcinogens. Moreover, Bcrp1 mediates transfer of [14C]IQ, [14C]Trp-P-1 and [3H]aflatoxin into milk, with 3.4+/-0.6, 2.6+/-0.3 and 3.8+/-0.5-fold higher milk to plasma ratios, respectively, in lactating wild-type versus Bcrp1-/- mice. We have thus identified Bcrp1/BCRP as one of the molecular mechanisms by which heterocyclic amines and aflatoxin are transferred into milk, thereby posing a health risk to breast-fed infants and dairy consumers. Paradoxically, Bcrp1/BCRP appears to have both protective and adverse roles with respect to exposure to dietary carcinogens.
Stem cells from a variety of tissues can be identified by a side population (SP) phenotype based on Hoechst 33342 dye efflux. The Abcg2 transporter is expressed in hematopoietic stem cells (HSCs) and confers this dye efflux activity. To further explore the relationship among Abcg2 expression, the SP phenotype, and HSC activity, we have generated mice in which a green fluorescent protein (GFP) reporter gene was inserted into the Abcg2 locus. In these mice, the majority of bone marrow (BM) cells that expressed the Abcg2/ GFP allele were Ter119(+) erythroid cells. The Abcg2/GFP allele was also expressed in approximately 10% of lineage-negative (Lin(-)) and in 91% of SP cells using stringent conditions for the SP assay. Flow cytometric sorting was used to isolate various Abcg2/GFP(+) BM cell populations that were then tested for HSC activity in transplant assays. There was significant enrichment for HSCs in sorted Lin(-)/ GFP(+) cells, with a calculated HSC frequency of approximately one in 75. There was no HSC activity detected in Lin(-)/GFP(+) cells. Altogether, these results show that Abcg2 is expressed on essentially all murine BM HSCs and can be used as a prospective marker for HSC enrichment.
ABC transporters pump out from cells a large number of endo- and xenobiotics including signal molecules and toxins; they are molecular markers of stem/progenitor cells as well. Here, we present the study of temporal/spatial patterns of Abcb1 isoforms and Abcg2 transporter expression and efflux activity in pre- and early postimplantation murine embryos. We found in 2-cell embryos abcb1a, abcb1b and abcg2 mRNAs which were believed to be maternally inherited. The expression of abcb1b and abcg2 genes was found in blastocysts and in 7 days postcoitum (dpc) embryos, while in 9dpc embryos beside of abcb1b/abcg2, the abcb1a gene was expressed. The abcb2 mRNA was detectable neither in pre- nor in postimplantation embryos. Moreover, we analysed temporal/spatial patterns of rhodamine 123/Hoechst 33342 efflux, which mirrors the ABC transporter phenotype, from individual cells of pre- and postimplantation murine embryos. The blastomeres of 2-, 4- and 8-cell embryos had efflux-inactive phenotype. Single, efflux-active cells emerged first in the morulae and their number increased in blastocyst inner cell mass. In 6 and 7 dpc embryos, all embryonic cells hold the efflux-active phenotype. Proximal embryonic endoderm of 6-8 dpc embryos contained two sub-domains: one consisted of efflux-active cells and another one of efflux-inactive cells reflecting polarity of an embryo. Between 7 and 8 dpc, at the onset of organogenesis, the vehement surge of efflux-inactive embryonic cells occurred, and their number increased in 9 dpc embryos, which consequently contained few efflux-active cells.
Antisense transcription (transcription from the opposite strand to a protein-coding or sense strand) has been ascribed roles in gene regulation involving degradation of the corresponding sense transcripts (RNA interference), as well as gene silencing at the chromatin level. Global transcriptome analysis provides evidence that a large proportion of the genome can produce transcripts from both strands, and that antisense transcripts commonly link neighboring "genes" in complex loci into chains of linked transcriptional units. Expression profiling reveals frequent concordant regulation of sense/antisense pairs. We present experimental evidence that perturbation of an antisense RNA can alter the expression of sense messenger RNAs, suggesting that antisense transcription contributes to control of transcriptional outputs in mammals.
ABCG2/BCRP is a member of the adenosine triphosphate-binding cassette (ABC) transporter family and is expressed in intestine, kidney, and liver, where it modulates the absorption and excretion of xenobiotic compounds. ABCG2 is also expressed in hematopoietic stem cells and erythroid cells; however, little is known regarding its role in hematopoiesis. Abcg2 null mice have increased levels of protoporphyrin IX (PPIX) in erythroid cells, yet the mechanism for this remains uncertain. We have found that Abcg2 mRNA expression was up-regulated in differentiating erythroid cells, coinciding with increased expression of other erythroid-specific genes. This expression pattern was associated with significant amounts of ABCG2 protein on the membrane of mature peripheral blood erythrocytes. Erythroid cells engineered to express ABCG2 had significantly lower intracellular levels of PPIX, suggesting the modulation of PPIX level by ABCG2. This modulating activity was abrogated by treatment with a specific ABCG2 inhibitor, Ko143, implying that PPIX may be a direct substrate for the transporter. Taken together, our results demonstrate that ABCG2 plays a role in regulating PPIX levels during erythroid differentiation and suggest a potential role for ABCG2 as a genetic determinant in erythropoietic protoporphyria.
Breast cancer resistance protein (Bcrp/Abcg2) is a member of the ABC transporter family. The purpose of this study was to quantify Bcrp mRNA in rat and mouse tissues, and to determine whether there are gender differences in Bcrp mRNA expression. Rat Bcrp mRNA levels were high in intestine and male kidney, and intermediate in testes. Mouse Bcrp expression was highest in kidney, followed by liver, ileum, and testes. Male-predominant expression of Bcrp was observed in rat kidney and mouse liver. Furthermore, gonadectomy and hypophysectomy experiments were conducted to determine whether sex steroids and/or growth hormone are responsible for Bcrp gender-divergent expression patterns. Male-predominant expression of Bcrp in rat kidney appears to be due to the suppressive effect of estradiol, and male-predominant expression of Bcrp in mouse liver appears to be due to the inductive effect of testosterone.
Contamination of milk with drugs, pesticides and other xenotoxins can pose a major health risk to breast-fed infants and dairy consumers. Here we show that the multidrug transporter BCRP (encoded by ABCG2) is strongly induced in the mammary gland of mice, cows and humans during lactation and that it is responsible for the active secretion of clinically and toxicologically important substrates such as the dietary carcinogen PhIP, the anticancer drug topotecan and the antiulcerative cimetidine into mouse milk.
The breast cancer resistance protein (BCRP/ABCG2) is an ATP-binding cassette drug efflux transporter present in the liver and other tissues that affects the pharmacological behavior of many compounds. To assess the possible role of BCRP in sex-dependent pharmacokinetics, we studied the in vivo disposition of several murine Bcrp1 substrates in male and female wild-type and Bcrp1 knockout mice. After oral administration of the antibiotic nitrofurantoin, the area under the plasma concentration-time curve in wild-type female mice was approximately 2-fold higher than in wild-type male mice. Moreover, after i.v. administration of nitrofurantoin, the antiulcerative cimetidine, the anticancer drug topotecan, and the carcinogen 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP), the plasma levels in wild-type female mice were all significantly higher than those in wild-type male mice. Analysis of the expression of murine Bcrp1 in several pharmacokinetically important tissues showed that only the hepatic Bcrp1 expression was higher in male mice compared with female mice. In line with this difference, the hepatobiliary excretion for nitrofurantoin and PhIP was, respectively, 9-fold higher and approximately 2-fold higher in male compared with female wild-type mice. No significant sex differences were observed in plasma levels or hepatobiliary excretion for any of the tested compounds in Bcrp1-/- mice, indicating that Bcrp1 was the main cause of the sex difference in wild-type mice. Analysis of hepatic expression of human BCRP also indicated a higher expression in men compared with women. In conclusion, sex-dependent expression of BCRP/Bcrp1 in the liver may be a cause of sex-specific variability in the pharmacokinetics of BCRP substrates, with potential impact on the clinical-therapeutic applications and toxicity risks of drugs.
Imatinib mesylate (signal transduction inhibitor 571, Gleevec) is a potent and selective tyrosine kinase inhibitor, which was shown to effectively inhibit platelet-derived growth factor-induced glioblastoma cell growth preclinically. However, in patients, a limited penetration of imatinib into the brain has been reported. Imatinib is transported in vitro and in vivo by P-glycoprotein (P-gp; ABCB1), which thereby limits its distribution into the brain in mice. Previously, imatinib was shown to potently inhibit human breast cancer resistance protein (BCRP; ABCG2). Here, we show that imatinib is efficiently transported by mouse Bcrp1 in transfected Madin-Darby canine kidney strain II (MDCKII) monolayers. Furthermore, we show that the clearance of i.v. imatinib is significantly decreased 1.6-fold in Bcrp1 knockout mice compared with wild-type mice. At t = 2 hours, the brain penetration of i.v. imatinib was significantly 2.5-fold increased in Bcrp1 knockout mice compared with control mice. We tested the hypothesis that P-gp and BCRP inhibitors, such as elacridar and pantoprazole, improve the brain penetration of imatinib. Firstly, we showed in vitro that pantoprazole and elacridar inhibit the Bcrp1-mediated transport of imatinib in MDCKII-Bcrp1 cells. Secondly, we showed that co-administration of pantoprazole or elacridar significantly reduced the clearance of i.v. imatinib in wild-type mice by respectively 1.7-fold and 1.5-fold. Finally, in wild-type mice treated with pantoprazole or elacridar, the brain penetration of i.v. imatinib significantly increased 1.8-fold and 4.2-fold, respectively. Moreover, the brain penetration of p.o. imatinib increased 5.2-fold when pantoprazole was co-administered in wild-type mice. Our results suggest that co-administration of BCRP and P-gp inhibitors may improve delivery of imatinib to malignant gliomas.
The ability of cells to export Hoechst 33342 can be used to identify a subpopulation of cells (side population [SP]) with characteristics of stem cells in many tissues. The ATP-binding cassette transporters Bcrp1 (Abcg2) and Mdr1a/1b (Abcb1a/1b) have been implicated as being responsible for this phenotype. To further explore the involvement of these transporters in the SP phenotype, we have generated Bcrp1/Mdr1a/1b triple knockout mice and studied the effect of their absence on the SP in bone marrow and mammary gland. Whereas in bone marrow Bcrp1 was almost exclusively responsible for the SP, both transporters contributed to the SP phenotype in the mammary gland, where their combined absence resulted in a nearly complete loss of SP. Interestingly, bone marrow of Mdr1a/1b-/- mice frequently displayed an elevated SP, which was reversible by the Bcrp1 inhibitor Ko143, suggesting that Bcrp1 can compensate for the loss of Mdr1a/1b in bone marrow.
This study describes comprehensive polling of transcription start and termination sites and analysis of previously unidentified full-length complementary DNAs derived from the mouse genome. We identify the 5' and 3' boundaries of 181,047 transcripts with extensive variation in transcripts arising from alternative promoter usage, splicing, and polyadenylation. There are 16,247 new mouse protein-coding transcripts, including 5154 encoding previously unidentified proteins. Genomic mapping of the transcriptome reveals transcriptional forests, with overlapping transcription on both strands, separated by deserts in which few transcripts are observed. The data provide a comprehensive platform for the comparative analysis of mammalian transcriptional regulation in differentiation and development.
Our studies demonstrate that the ABC transporter and marker of stem and progenitor cells known as the breast cancer resistance protein (BCRP or ABCG2) confers a strong survival advantage under hypoxic conditions. We show that, under hypoxia, progenitor cells from Bcrp(-)/(-)mice have a reduced ability to form colonies as compared with progenitor cells from Bcrp(+/+) mice. Blocking BCRP function in Bcrp(+/+) progenitor cells markedly reduces survival under hypoxic conditions. However, blocking heme biosynthesis reverses the hypoxic susceptibility of Bcrp(-/-) progenitor cells, a finding that indicates that heme molecules (i.e. porphyrins) are detrimental to Bcrp(-/-) cells under hypoxia. BCRP specifically binds heme, and cells lacking BCRP accumulate porphyrins. Finally, Bcrp expression is up-regulated by hypoxia, and we demonstrate that this up-regulation involves the hypoxia-inducible transcription factor complex HIF-1. Collectively, our findings suggest that cells can, upon hypoxic demand, use BCRP to reduce heme or porphyrin accumulation, which can be detrimental to cells. Our findings have implications for the survival of stem cells and tumor cells in hypoxic environments.
The National Institutes of Health's Mammalian Gene Collection (MGC) project was designed to generate and sequence a publicly accessible cDNA resource containing a complete open reading frame (ORF) for every human and mouse gene. The project initially used a random strategy to select clones from a large number of cDNA libraries from diverse tissues. Candidate clones were chosen based on 5'-EST sequences, and then fully sequenced to high accuracy and analyzed by algorithms developed for this project. Currently, more than 11,000 human and 10,000 mouse genes are represented in MGC by at least one clone with a full ORF. The random selection approach is now reaching a saturation point, and a transition to protocols targeted at the missing transcripts is now required to complete the mouse and human collections. Comparison of the sequence of the MGC clones to reference genome sequences reveals that most cDNA clones are of very high sequence quality, although it is likely that some cDNAs may carry missense variants as a consequence of experimental artifact, such as PCR, cloning, or reverse transcriptase errors. Recently, a rat cDNA component was added to the project, and ongoing frog (Xenopus) and zebrafish (Danio) cDNA projects were expanded to take advantage of the high-throughput MGC pipeline.
The breast cancer resistance protein (BCRP/ABCG2) is, like P-glycoprotein (P-gp), a member of the ABC family of drug transporters. These proteins actively transport various anticancer drugs from cells, causing multidrug resistance. The physiological expression of P-gp/ABCB1 at the blood-brain barrier (BBB) effectively restricts the brain uptake of many antitumor drugs by mediating their active efflux from the brain to the blood vessel lumen. However, little is known about the function of Abcg2 at the BBB in vivo. We used in situ brain perfusion to measure the uptake of two known Abcg2 substrates, prazosin and mitoxantrone, and the nonsubstrate vinblastine by the brains of wild-type and P-gp-deficient mutant mdr1a(-/-) mice with or without the P-gp/Abcg2 inhibitor GF120918 or the P-gp inhibitor PSC833. P-gp had no effect on the brain transport of prazosin and mitoxantrone at the mouse BBB, but wild-type and P-gp-deficient mouse brains perfused with GF120918 or a high concentration of prazosin showed carrier-mediated effluxes of prazosin and mitoxantrone from the brain that did not involve P-gp. In contrast, the brain uptake of vinblastine was restricted only by P-gp and not by Abcg2 at the BBB. The amounts of abcg2 mRNA in cortex homogenates and capillary-enriched fractions of wild-type and mdr1a(-/-) mouse brains were measured by real-time quantitative reverse transcription-PCR. There was approximately 700-times more abcg2 mRNA in brain microvessels than in the cortex of the wild-type mice, confirming that Abcg2 plays an important role at the BBB. There was also approximately 3 times more abcg2 mRNA in the microvessels from P-gp-deficient mutant mouse brains than in the microvessels of wild-type mouse brains. These findings confirm that Abcg2 is a physiological transporter at the BBB that restricts the permeability of the brain to its substrates in vivo. Lastly, the defective P-gp in the mutant mdr1a(-/-) mice was associated with increased abcg2 mRNA at the BBB and a greater export of prazosin and mitoxantrone from the brain, as measured in the P-gp-deficient mice versus the wild-type mice.
Stem cells are important in the maintenance and repair of adult tissues. A population of cells, termed side population (SP) cells, has stem cell characteristics as they have been shown to contribute to diverse lineages. In this study, we confirm that Abcg2 is a determinant of the SP cell phenotype. Therefore, we examined Abcg2 expression during murine embryogenesis and observed robust expression in the blood islands of the E8.5 yolk sac and in developing tissues including the heart. During the latter stages of embryogenesis, Abcg2 identifies a rare cell population in the developing organs. We further establish that the adult heart contains an Abcg2 expressing SP cell population and these progenitor cells are capable of proliferation and differentiation. We define the molecular signature of cardiac SP cells and compare it to embryonic stem cells and adult cardiomyocytes using emerging technologies. We propose that the cardiac SP cell population functions as a progenitor cell population for the development, maintenance, and repair of the heart.
Akt is an important regulator of cell survival, growth, and glucose metabolism in many cell types, but the role of this signaling molecule in hematopoietic stem cells is poorly defined. Side population (SP) cells are enriched for hematopoietic stem cell activity and are defined by their ability to efficiently efflux Hoechst 33342. Bone marrow from Akt1-null mice exhibited a reduced SP fraction. However, bone marrow cellularity, growth factor-responsive progenitor cultures, and engraftable stem cells were normal in these mice. Treatment of bone marrow with LY294002, an inhibitor of the Akt effector protein phosphatidylinositol 3-kinase, led to a reversible loss of the SP fraction. Bcrp1, which encodes the Hoechst dye transporter, was translocated from the membrane to the intracellular compartment under conditions that promote the SP-depleted state. Lentivirus-mediated overexpression of Akt1 in bone marrow markedly increased the SP fraction, whereas there was no effect on bone marrow from Bcrp(-/-) mice. These data suggest that Akt signaling modulates the SP cell phenotype by regulating the expression of Bcrp1.
The identification of the genes regulating neural progenitor cell (NPC) functions is of great importance to developmental neuroscience and neural repair. Previously, we combined genetic subtraction and microarray analysis to identify genes enriched in neural progenitor cultures. Here, we apply a strategy to further stratify the neural progenitor genes. In situ hybridization demonstrates expression in the central nervous system germinal zones of 54 clones so identified, making them highly relevant for study in brain and neural progenitor development. Using microarray analysis we find 73 genes enriched in three neural stem cell (NSC)-containing populations generated under different conditions. We use the custom microarray to identify 38 "stemness" genes, with enriched expression in the three NSC conditions and present in both embryonic stem cells and hematopoietic stem cells. However, comparison of expression profiles from these stem cell populations indicates that while there is shared gene expression, the amount of genetic overlap is no more than what would be expected by chance, indicating that different stem cells have largely different gene expression patterns. Taken together, these studies identify many genes not previously associated with neural progenitor cell biology and also provide a rational scheme for stratification of microarray data for functional analysis.
The breast cancer resistance protein [BCRP (BCRP/ABCG2)] has not previously been directly identified as a source of resistance to epipodophyllotoxins.However, when P-glycoprotein (P-gp)- and Mrp1-deficient mouse fibroblast and kidney cell lines were selected for resistance to etoposide, amplification and overexpression of Bcrp1 emerged as the dominant resistance mechanism in five of five cases. Resistance was accompanied by reduced intracellular etoposide accumulation. Bcrp1 sequence in all of the resistant lines was wild-type in the region spanning the R482 mutation hot spot known to alter the substrate specificity of mouse Bcrp1 (mouse cognate of BCRP) and human BCRP. Transduced wild-type Bcrp1 cDNA mediated resistance to etoposide and teniposide in fibroblast lines and trans-epithelial etoposide transport in polarized Madin-Darby canine kidney II cells. Bcrp1-mediated etoposide resistance was reversed by two structurally different BCRP/Bcrp1 inhibitors, GF120918 and Ko143. BCRP/Bcrp1 (inhibition) might thus impact on the antitumor activity and pharmacokinetics of epipodophyllotoxins. However, treatment of P-gp-deficient mice with GF120918 did not improve etoposide oral uptake, suggesting that Bcrp1 activity is not a major limiting factor in this process. In contrast, use of GF120918 to inhibit P-gp in wild-type mice increased the plasma levels of etoposide after oral administration 4-5-fold. It may thus be worthwhile to test inhibition of P-gp in humans to improve the oral availability of etoposide.
The breast cancer resistance protein (BCRPABCG2) is a member of the ATP-binding cassette family of drug transporters and confers resistance to various anticancer drugs. We show here that mice lacking Bcrp1Abcg2 become extremely sensitive to the dietary chlorophyll-breakdown product pheophorbide a, resulting in severe, sometimes lethal phototoxic lesions on light-exposed skin. Pheophorbide a occurs in various plant-derived foods and food supplements. Bcrp1 transports pheophorbide a and is highly efficient in limiting its uptake from ingested food. Bcrp1(-/-) mice also displayed a previously unknown type of protoporphyria. Erythrocyte levels of the heme precursor and phototoxin protoporphyrin IX, which is structurally related to pheophorbide a, were increased 10-fold. Transplantation with wild-type bone marrow cured the protoporphyria and reduced the phototoxin sensitivity of Bcrp1(-/-) mice. These results indicate that humans or animals with low or absent BCRP activity may be at increased risk for developing protoporphyria and diet-dependent phototoxicity and provide a striking illustration of the importance of drug transporters in protection from toxicity of normal food constituents.
The National Institutes of Health Mammalian Gene Collection (MGC) Program is a multiinstitutional effort to identify and sequence a cDNA clone containing a complete ORF for each human and mouse gene. ESTs were generated from libraries enriched for full-length cDNAs and analyzed to identify candidate full-ORF clones, which then were sequenced to high accuracy. The MGC has currently sequenced and verified the full ORF for a nonredundant set of >9,000 human and >6,000 mouse genes. Candidate full-ORF clones for an additional 7,800 human and 3,500 mouse genes also have been identified. All MGC sequences and clones are available without restriction through public databases and clone distribution networks (see http:mgc.nci.nih.gov).
Only a small proportion of the mouse genome is transcribed into mature messenger RNA transcripts. There is an international collaborative effort to identify all full-length mRNA transcripts from the mouse, and to ensure that each is represented in a physical collection of clones. Here we report the manual annotation of 60,770 full-length mouse complementary DNA sequences. These are clustered into 33,409 'transcriptional units', contributing 90.1% of a newly established mouse transcriptome database. Of these transcriptional units, 4,258 are new protein-coding and 11,665 are new non-coding messages, indicating that non-coding RNA is a major component of the transcriptome. 41% of all transcriptional units showed evidence of alternative splicing. In protein-coding transcripts, 79% of splice variations altered the protein product. Whole-transcriptome analyses resulted in the identification of 2,431 sense-antisense pairs. The present work, completely supported by physical clones, provides the most comprehensive survey of a mammalian transcriptome so far, and is a valuable resource for functional genomics.
Hematopoietic stem cells (HSCs) can be identified by a "side population" (SP) phenotype. Previous studies have implicated the ATP binding cassette transporter genes Mdr1a/1b and/or Bcrp1 in the SP phenotype. To define the relative role of these transporters, we generated Bcrp1 null mice and evaluated HSCs both functionally and phenotypically. Loss of Bcrp1 gene expression, but not Mdr1a/1b, led to a significant reduction in the number of SP cells in the bone marrow and in skeletal muscle. In the bone marrow, there was a nearly absolute loss of lineage negative, c-Kit-positive, Sca-1-positive SP cells, and the residual SP cells were depleted of repopulating cells in a transplant assay, demonstrating that Bcrp1 expression is necessary for the SP phenotype in HSCs. Furthermore, Bcrp1 null hematopoietic cells were significantly more sensitive to mitoxantrone in drug-treated transplanted mice. These results show that Bcrp1 gene expression alone defines the SP stem cell phenotype, and suggest that the physiological function of Bcrp1 expression in HSCs is to provide protection from cytotoxic substrates.
Genetic mechanisms regulating CNS progenitor function and differentiation are not well understood. We have used microarrays derived from a representational difference analysis (RDA) subtraction in a heterogeneous stem cell culture system to systematically study the gene expression patterns of CNS progenitors. This analysis identified both known and novel genes enriched in progenitor cultures. In situ hybridization in a subset of clones demonstrated that many of these genes were expressed preferentially in germinal zones, some showing distinct ventricular or subventricular zone labeling. Several genes were also enriched in hematopoietic stem cells, suggesting an overlap of gene expression in neural and hematopoietic progenitors. This combination of methods demonstrates the power of using custom microarrays derived from RDA-subtracted libraries for both gene discovery and gene expression analysis in the central nervous system.