Abcg2 | GeneID:26357 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 26357 Official Symbol Abcg2
Locus N/A Gene Type protein-coding
Synonyms ABC15; ABCP; AI428558; BCRP; Bcrp1; MXR; MXR1
Full Name ATP-binding cassette, sub-family G (WHITE), member 2
Description ATP-binding cassette, sub-family G (WHITE), member 2
Chromosome 6 B3|6 28.5 cM
Also Known As ATP-binding cassette, sub-family G, member 2; OTTMUSP00000025071; OTTMUSP00000025391; mitoxantrone resistance protein 1
Summary The membrane-associated protein encoded by this gene is included in the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily. Alternatively referred to as a breast cancer resistance protein, the human protein functions as a xenobiotic transporter which may play a major role in multi-drug resistance. This protein likely serves as a cellular defense mechanism in response to mitoxantrone and anthracycline exposure. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 55852

ID Symbol Protein Species
GeneID:9429 ABCG2 NP_004818.2 Homo sapiens
GeneID:26357 Abcg2 NP_036050.1 Mus musculus
GeneID:312382 Abcg2 NP_852046.1 Rattus norvegicus
GeneID:423767 ABCG2 XP_421638.2 Gallus gallus
GeneID:471251 ABCG2 XP_526633.2 Pan troglodytes
GeneID:478472 ABCG2 XP_535650.2 Canis lupus familiaris
GeneID:536203 ABCG2 NP_001032555.2 Bos taurus
GeneID:735310 abcg2d NP_001036237.1 Danio rerio
GeneID:811826 PF14_0244 XP_001348418.1 Plasmodium falciparum
GeneID:830541 AT5G06530 NP_850781.2 Arabidopsis thaliana
GeneID:850369 ADP1 NP_009937.2 Saccharomyces cerevisiae
GeneID:2679509 MGG_01563 XP_363637.2 Magnaporthe grisea
GeneID:2713604 NCU02544.1 XP_331743.1 Neurospora crassa
GeneID:2892892 KLLA0D04554g XP_453265.1 Kluyveromyces lactis
GeneID:4331674 Os03g0157400 NP_001049014.1 Oryza sativa
GeneID:4621257 AGOS_AER190W NP_985047.1 Eremothecium gossypii

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab24115 BCRP/ABCG2 antibody [BXP-53] (ab24115); Rat monoclonal [BXP-53] to BCRP/ABCG2
2 abcam ab24114 BCRP/ABCG2 antibody [BXP-9] (ab24114); Rat monoclonal [BXP-9] to BCRP/ABCG2
3 sigma B7185 Anti-Breast Cancer Resistance Protein antibody produced in rabbit ;

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0005886 Component plasma membrane
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0017111 Function nucleoside-triphosphatase activity
GO:0000166 Function nucleotide binding
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_011920  UCSC Browser NP_036050

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000031822 MI0000781 hsa-miR-373 GAAGUGCUUCGAUUUUGGGGUGU
ENSMUST00000031822 MI0003156 hsa-miR-518b CAAAGCGCUCCCCUUUAGAGGU
ENSMUST00000031822 MI0003159 hsa-miR-518c CAAAGCGCUUCUCUUUAGAGUGU
ENSMUST00000031822 MI0003171 hsa-miR-518d-3p CAAAGCGCUUCCCUUUGGAGC
ENSMUST00000031822 MI0003154 hsa-miR-518f GAAAGCGCUUCUCUUUAGAGG
ENSMUST00000031822 MI0003162 hsa-miR-519d CAAAGUGCCUCCCUUUAGAGUG
ENSMUST00000031822 MI0003145 hsa-miR-519e AAGUGCCUCCUUUUAGAGUGUU
ENSMUST00000031822 MI0003149 hsa-miR-520a-3p AAAGUGCUUCCCUUUGGACUGU
ENSMUST00000031822 MI0003155 hsa-miR-520b AAAGUGCUUCCUUUUAGAGGG
ENSMUST00000031822 MI0003158 hsa-miR-520c-3p AAAGUGCUUCCUUUUAGAGGGU
ENSMUST00000031822 MI0003164 hsa-miR-520d-3p AAAGUGCUUCUCUUUGGUGGGU
ENSMUST00000031822 MI0003143 hsa-miR-520e AAAGUGCUUCCUUUUUGAGGG
ENSMUST00000031822 MI0003146 hsa-miR-520f AAGUGCUUCCUUUUAGAGGGUU
ENSMUST00000031822 MI0003166 hsa-miR-520g ACAAAGUGCUUCCCUUUAGAGUGU
ENSMUST00000031822 MI0003175 hsa-miR-520h ACAAAGUGCUUCCCUUUAGAGU
ENSMUST00000031822 MI0003648 hsa-miR-633 CUAAUAGUAUCUACCACAAUAAA
ENSMUST00000031822 MI0005481 mmu-miR-105 CCAAGUGCUCAGAUGCUUGUGGU
ENSMUST00000031822 MI0000406 mmu-miR-106a CAAAGUGCUAACAGUGCAGGUAG
ENSMUST00000031822 MI0000407 mmu-miR-106b UAAAGUGCUGACAGUGCAGAU
ENSMUST00000031822 MI0000256 mmu-miR-122 UGGAGUGUGACAAUGGUGUUUG
ENSMUST00000031822 MI0000687 mmu-miR-17 CAAAGUGCUUACAGUGCAGGUAG
ENSMUST00000031822 MI0000568 mmu-miR-20a UAAAGUGCUUAUAGUGCAGGUAG
ENSMUST00000031822 MI0003536 mmu-miR-20b CAAAGUGCUCAUAGUGCAGGUAG
ENSMUST00000031822 MI0000388 mmu-miR-290-3p AAAGUGCCGCCUAGUUUUAAGCCC
ENSMUST00000031822 MI0000389 mmu-miR-291a-3p AAAGUGCUUCCACUUUGUGUGC
ENSMUST00000031822 MI0000389 mmu-miR-291a-5p CAUCAAAGUGGAGGCCCUCUCU
ENSMUST00000031822 MI0003539 mmu-miR-291b-3p AAAGUGCAUCCAUUUUGUUUGU
ENSMUST00000031822 MI0003539 mmu-miR-291b-5p GAUCAAAGUGGAGGCCCUCUCC
ENSMUST00000031822 MI0000390 mmu-miR-292-3p AAAGUGCCGCCAGGUUUUGAGUGU
ENSMUST00000031822 MI0000392 mmu-miR-294 AAAGUGCUUCCCUUUUGUGUGU
ENSMUST00000031822 MI0000393 mmu-miR-295 AAAGUGCUACUACUUUUGAGUCU
ENSMUST00000031822 MI0000401 mmu-miR-301a CAGUGCAAUAGUAUUGUCAAAGC
ENSMUST00000031822 MI0004122 mmu-miR-301b CAGUGCAAUGGUAUUGUCAAAGC
ENSMUST00000031822 MI0000402 mmu-miR-302a UAAGUGCUUCCAUGUUUUGGUGA
ENSMUST00000031822 MI0003716 mmu-miR-302b UAAGUGCUUCCAUGUUUUAGUAG
ENSMUST00000031822 MI0003717 mmu-miR-302c AAGUGCUUCCAUGUUUCAGUGG
ENSMUST00000031822 MI0003718 mmu-miR-302d UAAGUGCUUCCAUGUUUGAGUGU
ENSMUST00000031822 MI0002402 mmu-miR-467a UAAGUGCCUGCAUGUAUAUGCG
ENSMUST00000031822 MI0004671 mmu-miR-467b GUAAGUGCCUGCAUGUAUAUG
ENSMUST00000031822 MI0005513 mmu-miR-467d UAAGUGCGCGCAUGUAUAUGCG
ENSMUST00000031822 MI0004708 mmu-miR-721 CAGUGCAAUUAAAAGGGGGAA
ENSMUST00000031822 MI0004310 mmu-miR-764-5p GGUGCUCACAUGUCCUCCU
ENSMUST00000031822 MI0000581 mmu-miR-93 CAAAGUGCUGUUCGUGCAGGUAG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Scharenberg C, et al. (2009) "ABCG2 is expressed in late spermatogenesis and is associated with the acrosome." Biochem Biophys Res Commun. 378(2):302-307. PMID:19032939
  2. [ + ] Cattelotte J, et al. (2009) "Changes in dipole membrane potential at the mouse blood-brain barrier enhance the transport of 99mTechnetium Sestamibi more than inhibiting Abcb1, Abcc1, or Abcg2." J Neurochem. 108(3):767-775. PMID:19067785
  3. [ + ] Bleau AM, et al. (2009) "PTEN/PI3K/Akt pathway regulates the side population phenotype and ABCG2 activity in glioma tumor stem-like cells." Cell Stem Cell. 4(3):226-235. PMID:19265662
  4. [ + ] Shukla S, et al. (2009) "Curcumin inhibits the activity of ABCG2/BCRP1, a multidrug resistance-linked ABC drug transporter in mice." Pharm Res. 26(2):480-487. PMID:18841445
  5. [ + ] Zhou L, et al. (2008) "The breast cancer resistance protein (Bcrp1/Abcg2) limits fetal distribution of glyburide in the pregnant mouse: an Obstetric-Fetal Pharmacology Research Unit Network and University of Washington Specialized Center of Research Study." Mol Pharmacol. 73(3):949-959. PMID:18079276
  6. [ + ] Kim YJ, et al. (2008) "Comparative analysis of ABCG2-expressing and label-retaining cells in mouse submandibular gland." Cell Tissue Res. 334(1):47-53. PMID:18688650
  7. [ + ] Susanto J, et al. (2008) "Porphyrin homeostasis maintained by ABCG2 regulates self-renewal of embryonic stem cells." PLoS One. 3(12):e4023. PMID:19107196
  8. [ + ] Pfister O, et al. (2008) "Role of the ATP-binding cassette transporter Abcg2 in the phenotype and function of cardiac side population cells." Circ Res. 103(8):825-835. PMID:18787193
  9. [ + ] Muenster U, et al. (2008) "Characterization of substrates and inhibitors for the in vitro assessment of Bcrp mediated drug-drug interactions." Pharm Res. 25(10):2320-2326. PMID:18523872
  10. [ + ] Martin CM, et al. (2008) "Hypoxia-inducible factor-2alpha transactivates Abcg2 and promotes cytoprotection in cardiac side population cells." Circ Res. 102(9):1075-1081. PMID:18356544
  11. [ + ] Brendel C, et al. (2007) "Imatinib mesylate and nilotinib (AMN107) exhibit high-affinity interaction with ABCG2 on primitive hematopoietic stem cells." Leukemia. 21(6):1267-1275. PMID:17519960
  12. [ + ] Yamagata T, et al. (2007) "Improvement of the oral drug absorption of topotecan through the inhibition of intestinal xenobiotic efflux transporter, breast cancer resistance protein, by excipients." Drug Metab Dispos. 35(7):1142-1148. PMID:17446265
  13. [ + ] Pan G, et al. (2007) "Abcg2/Bcrp1 mediates the polarized transport of antiretroviral nucleosides abacavir and zidovudine." Drug Metab Dispos. 35(7):1165-1173. PMID:17437964
  14. [ + ] Jonker JW, et al. (2007) "Breast cancer resistance protein (Bcrp1/Abcg2) is expressed in the harderian gland and mediates transport of conjugated protoporphyrin IX." Am J Physiol Cell Physiol. 292(6):C2204-C2212. PMID:17314268
  15. [ + ] Bihorel S, et al. (2007) "Influence of breast cancer resistance protein (Abcg2) and p-glycoprotein (Abcb1a) on the transport of imatinib mesylate (Gleevec) across the mouse blood-brain barrier." J Neurochem. 102(6):1749-1757. PMID:17696988
  16. [ + ] Hasegawa M, et al. (2007) "Multidrug resistance-associated protein 4 is involved in the urinary excretion of hydrochlorothiazide and furosemide." J Am Soc Nephrol. 18(1):37-45. PMID:17135398
  17. [ + ] van Herwaarden AE, et al. (2007) "Multidrug transporter ABCG2/breast cancer resistance protein secretes riboflavin (vitamin B2) into milk." Mol Cell Biol. 27(4):1247-1253. PMID:17145775
  18. [ + ] Hirai T, et al. (2007) "PPARalpha agonists positively and negatively regulate the expression of several nutrient/drug transporters in mouse small intestine." Biol Pharm Bull. 30(11):2185-2190. PMID:17978498
  19. [ + ] de Vries NA, et al. (2007) "P-glycoprotein and breast cancer resistance protein: two dominant transporters working together in limiting the brain penetration of topotecan." Clin Cancer Res. 13(21):6440-6449. PMID:17975156
  20. [ + ] Zhang Y, et al. (2007) "Breast cancer resistance protein 1 limits fetal distribution of nitrofurantoin in the pregnant mouse." Drug Metab Dispos. 35(12):2154-2158. PMID:17785426
  21. [ + ] Gavrilova O, et al. (2007) "In vivo relevance of Mrp2-mediated biliary excretion of the Amanita mushroom toxin demethylphalloin." Biochim Biophys Acta. 1768(9):2070-2077. PMID:17707334
  22. [ + ] de Wolf CJ, et al. (2007) "cGMP transport by vesicles from human and mouse erythrocytes." FEBS J. 274(2):439-450. PMID:17229149
  23. [ + ] Takenaka K, et al. (2007) "Substrate overlap between Mrp4 and Abcg2/Bcrp affects purine analogue drug cytotoxicity and tissue distribution." Cancer Res. 67(14):6965-6972. PMID:17638908
  24. [ + ] Kalabis GM, et al. (2007) "Breast cancer resistance protein (Bcrp1/Abcg2) in mouse placenta and yolk sac: ontogeny and its regulation by progesterone." Placenta. 28(10):1073-1081. PMID:17524480
  25. [ + ] Wang H, et al. (2006) "Expression of the breast cancer resistance protein (Bcrp1/Abcg2) in tissues from pregnant mice: effects of pregnancy and correlations with nuclear receptors." Am J Physiol Endocrinol Metab. 291(6):E1295-E1304. PMID:17082346
  26. [ + ] Zong Y, et al. (2006) "Expression of mouse Abcg2 mRNA during hematopoiesis is regulated by alternative use of multiple leader exons and promoters." J Biol Chem. 281(40):29625-29632. PMID:16885162
  27. [ + ] Leggas M, et al. (2006) "Gefitinib modulates the function of multiple ATP-binding cassette transporters in vivo." Cancer Res. 66(9):4802-4807. PMID:16651435
  28. [ + ] van Herwaarden AE, et al. (2006) "Breast cancer resistance protein (Bcrp1/Abcg2) reduces systemic exposure of the dietary carcinogens aflatoxin B1, IQ and Trp-P-1 but also mediates their secretion into breast milk." Carcinogenesis. 27(1):123-130. PMID:16000399
  29. [ + ] Tadjali M, et al. (2006) "Prospective isolation of murine hematopoietic stem cells by expression of an Abcg2/GFP allele." Stem Cells. 24(6):1556-1563. PMID:16484343
  30. [ + ] Sawicki WT, et al. (2006) "Temporal/spatial expression and efflux activity of ABC transporter, P-glycoprotein/Abcb1 isoforms and Bcrp/Abcg2 during early murine development." Gene Expr Patterns. 6(7):738-746. PMID:16458078
  31. [ + ] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073
  32. [ + ] Zhou S, et al. (2005) "Increased expression of the Abcg2 transporter during erythroid maturation plays a role in decreasing cellular protoporphyrin IX levels." Blood. 105(6):2571-2576. PMID:15546952
  33. [ + ] Tanaka Y, et al. (2005) "Tissue distribution and hormonal regulation of the breast cancer resistance protein (Bcrp/Abcg2) in rats and mice." Biochem Biophys Res Commun. 326(1):181-187. PMID:15567169
  34. [ + ] Jonker JW, et al. (2005) "The breast cancer resistance protein BCRP (ABCG2) concentrates drugs and carcinogenic xenotoxins into milk." Nat Med. 11(2):127-129. PMID:15685169
  35. [ + ] Merino G, et al. (2005) "Sex-dependent expression and activity of the ATP-binding cassette transporter breast cancer resistance protein (BCRP/ABCG2) in liver." Mol Pharmacol. 67(5):1765-1771. PMID:15722455
  36. [ + ] Breedveld P, et al. (2005) "The effect of Bcrp1 (Abcg2) on the in vivo pharmacokinetics and brain penetration of imatinib mesylate (Gleevec): implications for the use of breast cancer resistance protein and P-glycoprotein inhibitors to enable the brain penetration of imatinib in patients." Cancer Res. 65(7):2577-2582. PMID:15805252
  37. [ + ] Jonker JW, et al. (2005) "Contribution of the ABC transporters Bcrp1 and Mdr1a/1b to the side population phenotype in mammary gland and bone marrow of mice." Stem Cells. 23(8):1059-1065. PMID:16002779
  38. [ + ] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072
  39. [ + ] Krishnamurthy P, et al. (2004) "The stem cell marker Bcrp/ABCG2 enhances hypoxic cell survival through interactions with heme." J Biol Chem. 279(23):24218-24225. PMID:15044468
  40. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  41. [ + ] Cisternino S, et al. (2004) "Expression, up-regulation, and transport activity of the multidrug-resistance protein Abcg2 at the mouse blood-brain barrier." Cancer Res. 64(9):3296-3301. PMID:15126373
  42. [ + ] Martin CM, et al. (2004) "Persistent expression of the ATP-binding cassette transporter, Abcg2, identifies cardiac SP cells in the developing and adult heart." Dev Biol. 265(1):262-275. PMID:14697368
  43. [ + ] Mogi M, et al. (2003) "Akt signaling regulates side population cell phenotype via Bcrp1 translocation." J Biol Chem. 278(40):39068-39075. PMID:12851395
  44. [ + ] Easterday MC, et al. (2003) "Neural progenitor genes. Germinal zone expression and analysis of genetic overlap in stem cell populations." Dev Biol. 264(2):309-322. PMID:14651920
  45. [ + ] Allen JD, et al. (2003) "Mouse breast cancer resistance protein (Bcrp1/Abcg2) mediates etoposide resistance and transport, but etoposide oral availability is limited primarily by P-glycoprotein." Cancer Res. 63(6):1339-1344. PMID:12649196
  46. [ + ] Jonker JW, et al. (2002) "The breast cancer resistance protein protects against a major chlorophyll-derived dietary phototoxin and protoporphyria." Proc Natl Acad Sci U S A. 99(24):15649-15654. PMID:12429862
  47. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  48. [ + ] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851
  49. [ + ] Zhou S, et al. (2002) "Bcrp1 gene expression is required for normal numbers of side population stem cells in mice, and confers relative protection to mitoxantrone in hematopoietic cells in vivo." Proc Natl Acad Sci U S A. 99(19):12339-12344. PMID:12218177
  50. [ + ] Geschwind DH, et al. (2001) "A genetic analysis of neural progenitor differentiation." Neuron. 29(2):325-339. PMID:11239426