ABCA12 | GeneID:26154 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 26154 Official Symbol ABCA12
Locus N/A Gene Type protein-coding
Synonyms DKFZp434G232; FLJ41584; ICR2B; LI2
Full Name ATP-binding cassette, sub-family A (ABC1), member 12
Description ATP-binding cassette, sub-family A (ABC1), member 12
Chromosome 2q34
Also Known As ATP-binding cassette, sub-family A, member 12; ichthyosis congenita II, lamellar ichthyosis B
Summary The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily, which is the only major ABC subfamily found exclusively in multicellular eukaryotes. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 45441

ID Symbol Protein Species
GeneID:26154 ABCA12 NP_775099.2 Homo sapiens
GeneID:74591 Abca12 XP_001002308.2 Mus musculus
GeneID:424011 ABCA12 XP_421867.2 Gallus gallus
GeneID:459924 ABCA12 XP_516070.2 Pan troglodytes
GeneID:478900 ABCA12 XP_536058.2 Canis lupus familiaris
GeneID:558335 abca12 XP_686632.3 Danio rerio

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 scbt ABCA12 ABCA12 Antibody / ABCA12 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABCA12 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABCA12 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0019725 Process cellular homeostasis
GO:0006869 Process lipid transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_015657  UCSC Browser NP_056472
2 NM_173076  UCSC Browser NP_775099

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000272895 MI0000068 hsa-let-7f-2* CUAUACAGUCUACUGUCUUUCC
ENST00000272895 MI0000102 hsa-miR-100* CAAGCUUGUAUCUAUAGGUAUG
ENST00000272895 MI0000471 hsa-miR-126 UCGUACCGUGAGUAAUAAUGCG
ENST00000272895 MI0000460 hsa-miR-144 UACAGUAUAGAUGAUGUACU
ENST00000272895 MI0000270 hsa-miR-181b AACAUUCAUUGCUGUCGGUGGGU
ENST00000272895 MI0000683 hsa-miR-181b AACAUUCAUUGCUGUCGGUGGGU
ENST00000272895 MI0003139 hsa-miR-181d AACAUUCAUUGUUGUCGGUGGGU
ENST00000272895 MI0000081 hsa-miR-24-2* UGCCUACUGAGCUGAAACACAG
ENST00000272895 MI0000088 hsa-miR-30a UGUAAACAUCCUCGACUGGAAG
ENST00000272895 MI0000441 hsa-miR-30b UGUAAACAUCCUACACUCAGCU
ENST00000272895 MI0000254 hsa-miR-30c UGUAAACAUCCUACACUCUCAGC
ENST00000272895 MI0000736 hsa-miR-30c UGUAAACAUCCUACACUCUCAGC
ENST00000272895 MI0000255 hsa-miR-30d UGUAAACAUCCCCGACUGGAAG
ENST00000272895 MI0000762 hsa-miR-362-3p AACACACCUAUUCAAGGAUUCA
ENST00000272895 MI0005566 hsa-miR-374b* CUUAGCAGGUUGUAUUAUCAUU
ENST00000272895 MI0003183 hsa-miR-499-3p AACAUCACAGCAAGUCUGUGCU
ENST00000272895 MI0003193 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
ENST00000272895 MI0003159 hsa-miR-518c CAAAGCGCUUCUCUUUAGAGUGU
ENST00000272895 MI0003171 hsa-miR-518d-3p CAAAGCGCUUCCCUUUGGAGC
ENST00000272895 MI0003169 hsa-miR-518e AAAGCGCUUCCCUUCAGAGUG
ENST00000272895 MI0003154 hsa-miR-518f GAAAGCGCUUCUCUUUAGAGG
ENST00000272895 MI0003581 hsa-miR-574-3p CACGCUCAUGCACACACCCACA
ENST00000272895 MI0003619 hsa-miR-606 AAACUACUGAAAAUCAAAGAU
ENST00000272895 MI0003647 hsa-miR-632 GUGUCUGCUUCCUGUGGGA
ENST00000272895 MI0005760 hsa-miR-938 UGCCCUUAAAGGUGAACCCAGU
ENST00000272895 MI0002637 mml-miR-189 GUGCCUACUGAGCUGAUAUCAGU
ENST00000272895 MI0002401 mmu-miR-466a-3p UAUACAUACACGCACACAUAAGA
ENST00000272895 MI0005504 mmu-miR-466b-3-3p AAUACAUACACGCACACAUAAGA
ENST00000272895 MI0005546 mmu-miR-466d-3p UAUACAUACACGCACACAUAG
ENST00000272895 MI0005507 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000272895 MI0005508 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000272895 MI0005509 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000272895 MI0005510 mmu-miR-466g AUACAGACACAUGCACACACA
ENST00000272895 MI0004647 mmu-miR-684 AGUUUUCCCUUCAAGUCAA
ENST00000272895 MI0004648 mmu-miR-684 AGUUUUCCCUUCAAGUCAA
ENST00000272895 MI0004659 mmu-miR-691 AUUCCUGAAGAGAGGCAGAAAA
ENST00000272895 MI0004691 mmu-miR-707 CAGUCAUGCCGCUUGCCUACG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
ICHTHYOSIS CONGENITA, HARLEQUIN FETUS TYPE marker
Ichthyosis, Lamellar marker 16675967

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Thomas AC, et al. (2009) "Premature terminal differentiation and a reduction in specific proteases associated with loss of ABCA12 in Harlequin ichthyosis." Am J Pathol. 174(3):970-978. PMID:19179616
  2. [ + ] Jiang YJ, et al. (2008) "PPAR and LXR activators regulate ABCA12 expression in human keratinocytes." J Invest Dermatol. 128(1):104-109. PMID:17611579
  3. [ + ] Thomas AC, et al. (2008) "Novel and recurring ABCA12 mutations associated with harlequin ichthyosis: implications for prenatal diagnosis." Br J Dermatol. 158(3):611-613. PMID:17986308
  4. [ + ] Sakai K, et al. (2007) "Localization of ABCA12 from Golgi apparatus to lamellar granules in human upper epidermal keratinocytes." Exp Dermatol. 16(11):920-926. PMID:17927575
  5. [ + ] Natsuga K, et al. (2007) "Novel ABCA12 mutations identified in two cases of non-bullous congenital ichthyosiform erythroderma associated with multiple skin malignant neoplasia." J Invest Dermatol. 127(11):2669-2673. PMID:17508018
  6. [ + ] Yamanaka Y, et al. (2007) "Expression of the keratinocyte lipid transporter ABCA12 in developing and reconstituted human epidermis." Am J Pathol. 171(1):43-52. PMID:17591952
  7. [ + ] Thomas AC, et al. (2006) "ABCA12 is the major harlequin ichthyosis gene." J Invest Dermatol. 126(11):2408-2413. PMID:16902423
  8. [ + ] Ohkubo T, et al. (2005) "No genetic association between ATP binding cassette proteins and Japanese sporadic Alzheimer's disease." Dement Geriatr Cogn Disord. 20(2-3):95-98. PMID:15980630
  9. [ + ] Kelsell DP, et al. (2005) "Mutations in ABCA12 underlie the severe congenital skin disease harlequin ichthyosis." Am J Hum Genet. 76(5):794-803. PMID:15756637
  10. [ + ] Akiyama M, et al. (2005) "Mutations in lipid transporter ABCA12 in harlequin ichthyosis and functional recovery by corrective gene transfer." J Clin Invest. 115(7):1777-1784. PMID:16007253
  11. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  12. [ + ] Lefevre C, et al. (2003) "Mutations in the transporter ABCA12 are associated with lamellar ichthyosis type 2." Hum Mol Genet. 12(18):2369-2378. PMID:12915478
  13. [ + ] Annilo T, et al. (2002) "Identification and characterization of a novel ABCA subfamily member, ABCA12, located in the lamellar ichthyosis region on 2q34." Cytogenet Genome Res. 98(2-3):169-176. PMID:12697999
  14. [ + ] Dean M, et al. (2001) "The human ATP-binding cassette (ABC) transporter superfamily." Genome Res. 11(7):1156-1166. PMID:11435397
  15. [ + ] Parmentier L, et al. (1999) "Lamellar ichthyosis: further narrowing, physical and expression mapping of the chromosome 2 candidate locus." Eur J Hum Genet. 7(1):77-87. PMID:10094194
  16. [ + ] Parmentier L, et al. (1996) "Mapping of a second locus for lamellar ichthyosis to chromosome 2q33-35." Hum Mol Genet. 5(4):555-559. PMID:8845852
  17. [ + ] Allikmets R, et al. (1996) "Characterization of the human ABC superfamily: isolation and mapping of 21 new genes using the expressed sequence tags database." Hum Mol Genet. 5(10):1649-1655. PMID:8894702