ABHD12 | GeneID:26090 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 26090 Official Symbol ABHD12
Locus RP5-965G21.2 Gene Type protein-coding
Synonyms ABHD12A; BEM46L2; C20orf22; DKFZp434P106; dJ965G21.2
Full Name abhydrolase domain containing 12
Description abhydrolase domain containing 12
Chromosome 20p11.21
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 22910

ID Symbol Protein Species
GeneID:26090 ABHD12 NP_001035937.1 Homo sapiens
GeneID:37200 CG15111 NP_611397.1 Drosophila melanogaster
GeneID:76192 Abhd12 NP_077785.1 Mus musculus
GeneID:179172 Y97E10AL.2 NP_505054.1 Caenorhabditis elegans
GeneID:421249 ABHD12 NP_001012889.1 Gallus gallus
GeneID:477004 ABHD12 XP_534202.2 Canis lupus familiaris
GeneID:499913 Abhd12 NP_001019485.1 Rattus norvegicus
GeneID:767657 abhd12 NP_001070065.1 Danio rerio
GeneID:768242 ABHD12 XP_001253369.1 Bos taurus
GeneID:1268858 ENSANGG00000010983 XP_307433.2 Anopheles gambiae
GeneID:1280498 ENSANGG00000011561 XP_320345.2 Anopheles gambiae

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 acris AP16971PU-N ABHD12; antibody Ab

Exon, Intron and UTRs

Exon, Intron and UTRs of ABHD12 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABHD12 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0047372 Function acylglycerol lipase activity

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001042472  UCSC Browser NP_001035937
2 NM_015600  UCSC Browser NP_056415

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000339157 MI0000108 hsa-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENST00000339157 MI0000109 hsa-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENST00000339157 MI0000114 hsa-miR-107 AGCAGCAUUGUACAGGGCUAUCA
ENST00000339157 MI0000253 hsa-miR-148a UCAGUGCACUACAGAACUUUGU
ENST00000339157 MI0000811 hsa-miR-148b UCAGUGCAUCACAGAACUUUGU
ENST00000339157 MI0001518 hsa-miR-18b* UGCCCUAAAUGCCCCUUCUGGC
ENST00000339157 MI0000298 hsa-miR-221 AGCUACAUUGUCUGCUGGGUUUC
ENST00000339157 MI0000299 hsa-miR-222 AGCUACAUCUGGCUACUGGGU
ENST00000339157 MI0000080 hsa-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENST00000339157 MI0000081 hsa-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENST00000339157 MI0000743 hsa-miR-34c-5p AGGCAGUGUAGUUAGCUGAUUGC
ENST00000339157 MI0001445 hsa-miR-423-3p AGCUCGGUCUGAGGCCCCUCAGU
ENST00000339157 MI0001445 hsa-miR-423-5p UGAGGGGCAGAGAGCGAGACUUU
ENST00000339157 MI0001648 hsa-miR-449a UGGCAGUGUAUUGUUAGCUGGU
ENST00000339157 MI0003673 hsa-miR-449b AGGCAGUGUAUUGUUAGCUGGC
ENST00000339157 MI0002467 hsa-miR-483-5p AAGACGGGAGGAAAGAAGGGAG
ENST00000339157 MI0002470 hsa-miR-486-3p CGGGGCAGCUCAGUACAGGAU
ENST00000339157 MI0003125 hsa-miR-490-3p CAACCUGGAGGACUCCAUGCUG
ENST00000339157 MI0003136 hsa-miR-496 UGAGUAUUACAUGGCCAAUCUC
ENST00000339157 MI0003180 hsa-miR-516a-3p UGCUUCCUUUCAGAGGGU
ENST00000339157 MI0003181 hsa-miR-516a-3p UGCUUCCUUUCAGAGGGU
ENST00000339157 MI0003515 hsa-miR-544 AUUCUGCAUUUUUAGCAAGUUC
ENST00000339157 MI0003578 hsa-miR-571 UGAGUUGGCCAUCUGAGUGAG
ENST00000339157 MI0003621 hsa-miR-608 AGGGGUGGUGUUGGGACAGCUCCGU
ENST00000339157 MI0003628 hsa-miR-615-3p UCCGAGCCUGGGUCUCCCUCUU
ENST00000339157 MI0003633 hsa-miR-619 GACCUGGACAUGUUUGUGCCCAGU
ENST00000339157 MI0003647 hsa-miR-632 GUGUCUGCUUCCUGUGGGA
ENST00000339157 MI0003676 hsa-miR-654-3p UAUGUCUGCUGACCAUCACCUU
ENST00000339157 MI0003670 hsa-miR-662 UCCCACGUUGUGGCCCAGCAG
ENST00000339157 MI0005416 hsa-miR-675 UGGUGCGGAGAGGGCCCACAGUG
ENST00000339157 MI0005559 hsa-miR-744* CUGUUGCCACUAACCUCAACCU
ENST00000339157 MI0003834 hsa-miR-769-3p CUGGGAUCUCCGGGGUCUUGGUU
ENST00000339157 MI0000746 hsa-miR-99b* CAAGCUCGUGUCUGUGGGUCCG
ENST00000339157 MI0003518 mmu-miR-540-5p CAAGGGUCACCCUCUGACUCUGU
ENST00000339157 MI0004683 mmu-miR-699 AGGCAGUGCGACCUGGCUCG
ENST00000339157 MI0004691 mmu-miR-707 CAGUCAUGCCGCUUGCCUACG
ENST00000339157 MI0004516 mmu-miR-763 CCAGCUGGGAAGAACCAGUGGC
ENST00000339157 MI0005476 mmu-miR-883a-5p UGCUGAGAGAAGUAGCAGUUAC
ENST00000376542 MI0000064 hsa-let-7c* UAGAGUUACACCCUGGGAGUUA
ENST00000376542 MI0000810 hsa-miR-135b* AUGUAGGGCUAAAAGCCAUGGG
ENST00000376542 MI0000459 hsa-miR-143* GGUGCAGUGCUGCAUCUCUGGU
ENST00000376542 MI0000253 hsa-miR-148a UCAGUGCACUACAGAACUUUGU
ENST00000376542 MI0000811 hsa-miR-148b UCAGUGCAUCACAGAACUUUGU
ENST00000376542 MI0000462 hsa-miR-152 UCAGUGCAUGACAGAACUUGG
ENST00000376542 MI0000272 hsa-miR-182 UUUGGCAAUGGUAGAACUCACACU
ENST00000376542 MI0000296 hsa-miR-219-1-3p AGAGUUGAGUCUGGACGUCCCG
ENST00000376542 MI0000078 hsa-miR-22 AAGCUGCCAGUUGAAGAACUGU
ENST00000376542 MI0000078 hsa-miR-22* AGUUCUUCAGUGGCAAGCUUUA
ENST00000376542 MI0000084 hsa-miR-26b* CCUGUUCUCCAUUACUUGGCUC
ENST00000376542 MI0000088 hsa-miR-30a* CUUUCAGUCGGAUGUUUGCAGC
ENST00000376542 MI0000255 hsa-miR-30d* CUUUCAGUCAGAUGUUUGCUGC
ENST00000376542 MI0000749 hsa-miR-30e* CUUUCAGUCGGAUGUUUACAGC
ENST00000376542 MI0002464 hsa-miR-412 ACUUCACCUGGUCCACUAGCCGU
ENST00000376542 MI0001729 hsa-miR-451 AAACCGUUACCAUUACUGAGUU
ENST00000376542 MI0002470 hsa-miR-486-3p CGGGGCAGCUCAGUACAGGAU
ENST00000376542 MI0003171 hsa-miR-518d-5p CUCUAGAGGGAAGCACUUUCUG
ENST00000376542 MI0003169 hsa-miR-518e* CUCUAGAGGGAAGCGCUUUCUG
ENST00000376542 MI0003154 hsa-miR-518f* CUCUAGAGGGAAGCACUUUCUC
ENST00000376542 MI0003563 hsa-miR-557 GUUUGCACGGGUGGGCCUUGUCU
ENST00000376542 MI0003591 hsa-miR-584 UUAUGGUUUGCCUGGGACUGAG
ENST00000376542 MI0003609 hsa-miR-597 UGUGUCACUCGAUGACCACUGU
ENST00000376542 MI0003647 hsa-miR-632 GUGUCUGCUUCCUGUGGGA
ENST00000376542 MI0003676 hsa-miR-654-3p UAUGUCUGCUGACCAUCACCUU
ENST00000376542 MI0005528 hsa-miR-892a CACUGUGUCCUUUCUGCGUAG
ENST00000376542 MI0002400 mmu-miR-465a-3p GAUCAGGGCCUUUCUAAGUAGA
ENST00000376542 MI0002400 mmu-miR-465a-5p UAUUUAGAAUGGCACUGAUGUGA
ENST00000376542 MI0005498 mmu-miR-465b-5p UAUUUAGAAUGGUGCUGAUCUG
ENST00000376542 MI0005499 mmu-miR-465b-5p UAUUUAGAAUGGUGCUGAUCUG
ENST00000376542 MI0005500 mmu-miR-465c-5p UAUUUAGAAUGGCGCUGAUCUG
ENST00000376542 MI0005501 mmu-miR-465c-5p UAUUUAGAAUGGCGCUGAUCUG
ENST00000376542 MI0005510 mmu-miR-466g AUACAGACACAUGCACACACA
ENST00000376542 MI0004666 mmu-miR-669b AGUUUUGUGUGCAUGUGCAUGU
ENST00000376542 MI0004699 mmu-miR-714 CGACGAGGGCCGGUCGGUCGC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Ethinyl Estradiol
  • Ethinyl Estradiol affects the expression of ABHD12 mRNA
17555576
pirinixic acid
  • pirinixic acid results in decreased expression of ABHD12 mRNA
17426115
Tamoxifen
  • Tamoxifen affects the expression of ABHD12 mRNA
17555576

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Breast Neoplasms inferred via Tamoxifen 16202921, 16818667, 15668708, 17440819, 17893378, 17261762, 17049068, 16873071, 11161223, 15565566, 17242785
Carcinoma, Hepatocellular inferred via Tamoxifen 16924424
Carcinoma, Transitional Cell inferred via Tamoxifen 17572228
Endometrial Neoplasms inferred via Tamoxifen 16202921, 17893378
Fatty Liver inferred via Tamoxifen 14986274
Female Urogenital Diseases inferred via Tamoxifen 16709447
Lipidoses inferred via Tamoxifen 15342952
Liver Cirrhosis, Experimental inferred via Tamoxifen 18564211
Liver Neoplasms inferred via Tamoxifen 16684651
Mammary Neoplasms, Experimental inferred via Tamoxifen 11731420, 16827153, 14580682
Melanoma inferred via Tamoxifen 12393984
Melanoma, Amelanotic inferred via Tamoxifen 15990972
Spermatocele inferred via Tamoxifen 16709447
Urinary Bladder Neoplasms inferred via Tamoxifen 16712894, 17572228
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 17333356, 15861022, 11677210, 16105132, 17681005, 16919318
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Otsuki T, et al. (2005) "Signal sequence and keyword trap in silico for selection of full-length human cDNAs encoding secretion or membrane proteins from oligo-capped cDNA libraries." DNA Res. 12(2):117-126. PMID:16303743
  2. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  3. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  4. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  5. [ + ] Deloukas P, et al. (2001) "The DNA sequence and comparative analysis of human chromosome 20." Nature. 414(6866):865-871. PMID:11780052