ABHD12 | GeneID:26090 | Homo sapiens
Gene Summary
[
] NCBI Entrez Gene
| Gene ID | 26090 | Official Symbol | ABHD12 |
|---|---|---|---|
| Locus | RP5-965G21.2 | Gene Type | protein-coding |
| Synonyms | ABHD12A; BEM46L2; C20orf22; DKFZp434P106; dJ965G21.2 | ||
| Full Name | abhydrolase domain containing 12 | ||
| Description | abhydrolase domain containing 12 | ||
| Chromosome | 20p11.21 | ||
| Also Known As | |||
| Summary | N/A | ||
Orthologs and Paralogs
[
] Homologs - NCBI's HomoloGene Group: 22910
| ID | Symbol | Protein | Species |
|---|---|---|---|
| GeneID:26090 | ABHD12 | NP_001035937.1 | Homo sapiens |
| GeneID:37200 | CG15111 | NP_611397.1 | Drosophila melanogaster |
| GeneID:76192 | Abhd12 | NP_077785.1 | Mus musculus |
| GeneID:179172 | Y97E10AL.2 | NP_505054.1 | Caenorhabditis elegans |
| GeneID:421249 | ABHD12 | NP_001012889.1 | Gallus gallus |
| GeneID:477004 | ABHD12 | XP_534202.2 | Canis lupus familiaris |
| GeneID:499913 | Abhd12 | NP_001019485.1 | Rattus norvegicus |
| GeneID:767657 | abhd12 | NP_001070065.1 | Danio rerio |
| GeneID:768242 | ABHD12 | XP_001253369.1 | Bos taurus |
| GeneID:1268858 | ENSANGG00000010983 | XP_307433.2 | Anopheles gambiae |
| GeneID:1280498 | ENSANGG00000011561 | XP_320345.2 | Anopheles gambiae |
Antibodies
[
] Monoclonal and Polyclonal Antibodies
| No. | Provider | Product No. | Description |
|---|---|---|---|
| 1 | acris | AP16971PU-N | ABHD12; antibody Ab |
Gene Classification
[
] Gene Ontology
| ID | Category | GO Term |
|---|---|---|
| GO:0047372 | Function | acylglycerol lipase activity |
RefSeq Isoforms
[
] RefSeq Annotation and UniProt Database
| No. | RefSeq RNA | RefSeq Protein | UniProt Equivalent |
|---|---|---|---|
| 1 | NM_001042472 UCSC Browser | NP_001035937 | |
| 2 | NM_015600 UCSC Browser | NP_056415 | |
MicroRNA and Targets
[
] MicroRNA Sequences and Transcript Targets from miRBase at Sanger
| RNA Target | miRNA # | mat miRNA | Mature miRNA Sequence |
|---|---|---|---|
| ENST00000339157 | MI0000108 | hsa-miR-103 | AGCAGCAUUGUACAGGGCUAUGA |
| ENST00000339157 | MI0000109 | hsa-miR-103 | AGCAGCAUUGUACAGGGCUAUGA |
| ENST00000339157 | MI0000114 | hsa-miR-107 | AGCAGCAUUGUACAGGGCUAUCA |
| ENST00000339157 | MI0000253 | hsa-miR-148a | UCAGUGCACUACAGAACUUUGU |
| ENST00000339157 | MI0000811 | hsa-miR-148b | UCAGUGCAUCACAGAACUUUGU |
| ENST00000339157 | MI0001518 | hsa-miR-18b* | UGCCCUAAAUGCCCCUUCUGGC |
| ENST00000339157 | MI0000298 | hsa-miR-221 | AGCUACAUUGUCUGCUGGGUUUC |
| ENST00000339157 | MI0000299 | hsa-miR-222 | AGCUACAUCUGGCUACUGGGU |
| ENST00000339157 | MI0000080 | hsa-miR-24 | UGGCUCAGUUCAGCAGGAACAG |
| ENST00000339157 | MI0000081 | hsa-miR-24 | UGGCUCAGUUCAGCAGGAACAG |
| ENST00000339157 | MI0000743 | hsa-miR-34c-5p | AGGCAGUGUAGUUAGCUGAUUGC |
| ENST00000339157 | MI0001445 | hsa-miR-423-3p | AGCUCGGUCUGAGGCCCCUCAGU |
| ENST00000339157 | MI0001445 | hsa-miR-423-5p | UGAGGGGCAGAGAGCGAGACUUU |
| ENST00000339157 | MI0001648 | hsa-miR-449a | UGGCAGUGUAUUGUUAGCUGGU |
| ENST00000339157 | MI0003673 | hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC |
| ENST00000339157 | MI0002467 | hsa-miR-483-5p | AAGACGGGAGGAAAGAAGGGAG |
| ENST00000339157 | MI0002470 | hsa-miR-486-3p | CGGGGCAGCUCAGUACAGGAU |
| ENST00000339157 | MI0003125 | hsa-miR-490-3p | CAACCUGGAGGACUCCAUGCUG |
| ENST00000339157 | MI0003136 | hsa-miR-496 | UGAGUAUUACAUGGCCAAUCUC |
| ENST00000339157 | MI0003180 | hsa-miR-516a-3p | UGCUUCCUUUCAGAGGGU |
| ENST00000339157 | MI0003181 | hsa-miR-516a-3p | UGCUUCCUUUCAGAGGGU |
| ENST00000339157 | MI0003515 | hsa-miR-544 | AUUCUGCAUUUUUAGCAAGUUC |
| ENST00000339157 | MI0003578 | hsa-miR-571 | UGAGUUGGCCAUCUGAGUGAG |
| ENST00000339157 | MI0003621 | hsa-miR-608 | AGGGGUGGUGUUGGGACAGCUCCGU |
| ENST00000339157 | MI0003628 | hsa-miR-615-3p | UCCGAGCCUGGGUCUCCCUCUU |
| ENST00000339157 | MI0003633 | hsa-miR-619 | GACCUGGACAUGUUUGUGCCCAGU |
| ENST00000339157 | MI0003647 | hsa-miR-632 | GUGUCUGCUUCCUGUGGGA |
| ENST00000339157 | MI0003676 | hsa-miR-654-3p | UAUGUCUGCUGACCAUCACCUU |
| ENST00000339157 | MI0003670 | hsa-miR-662 | UCCCACGUUGUGGCCCAGCAG |
| ENST00000339157 | MI0005416 | hsa-miR-675 | UGGUGCGGAGAGGGCCCACAGUG |
| ENST00000339157 | MI0005559 | hsa-miR-744* | CUGUUGCCACUAACCUCAACCU |
| ENST00000339157 | MI0003834 | hsa-miR-769-3p | CUGGGAUCUCCGGGGUCUUGGUU |
| ENST00000339157 | MI0000746 | hsa-miR-99b* | CAAGCUCGUGUCUGUGGGUCCG |
| ENST00000339157 | MI0003518 | mmu-miR-540-5p | CAAGGGUCACCCUCUGACUCUGU |
| ENST00000339157 | MI0004683 | mmu-miR-699 | AGGCAGUGCGACCUGGCUCG |
| ENST00000339157 | MI0004691 | mmu-miR-707 | CAGUCAUGCCGCUUGCCUACG |
| ENST00000339157 | MI0004516 | mmu-miR-763 | CCAGCUGGGAAGAACCAGUGGC |
| ENST00000339157 | MI0005476 | mmu-miR-883a-5p | UGCUGAGAGAAGUAGCAGUUAC |
| ENST00000376542 | MI0000064 | hsa-let-7c* | UAGAGUUACACCCUGGGAGUUA |
| ENST00000376542 | MI0000810 | hsa-miR-135b* | AUGUAGGGCUAAAAGCCAUGGG |
| ENST00000376542 | MI0000459 | hsa-miR-143* | GGUGCAGUGCUGCAUCUCUGGU |
| ENST00000376542 | MI0000253 | hsa-miR-148a | UCAGUGCACUACAGAACUUUGU |
| ENST00000376542 | MI0000811 | hsa-miR-148b | UCAGUGCAUCACAGAACUUUGU |
| ENST00000376542 | MI0000462 | hsa-miR-152 | UCAGUGCAUGACAGAACUUGG |
| ENST00000376542 | MI0000272 | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACACU |
| ENST00000376542 | MI0000296 | hsa-miR-219-1-3p | AGAGUUGAGUCUGGACGUCCCG |
| ENST00000376542 | MI0000078 | hsa-miR-22 | AAGCUGCCAGUUGAAGAACUGU |
| ENST00000376542 | MI0000078 | hsa-miR-22* | AGUUCUUCAGUGGCAAGCUUUA |
| ENST00000376542 | MI0000084 | hsa-miR-26b* | CCUGUUCUCCAUUACUUGGCUC |
| ENST00000376542 | MI0000088 | hsa-miR-30a* | CUUUCAGUCGGAUGUUUGCAGC |
| ENST00000376542 | MI0000255 | hsa-miR-30d* | CUUUCAGUCAGAUGUUUGCUGC |
| ENST00000376542 | MI0000749 | hsa-miR-30e* | CUUUCAGUCGGAUGUUUACAGC |
| ENST00000376542 | MI0002464 | hsa-miR-412 | ACUUCACCUGGUCCACUAGCCGU |
| ENST00000376542 | MI0001729 | hsa-miR-451 | AAACCGUUACCAUUACUGAGUU |
| ENST00000376542 | MI0002470 | hsa-miR-486-3p | CGGGGCAGCUCAGUACAGGAU |
| ENST00000376542 | MI0003171 | hsa-miR-518d-5p | CUCUAGAGGGAAGCACUUUCUG |
| ENST00000376542 | MI0003169 | hsa-miR-518e* | CUCUAGAGGGAAGCGCUUUCUG |
| ENST00000376542 | MI0003154 | hsa-miR-518f* | CUCUAGAGGGAAGCACUUUCUC |
| ENST00000376542 | MI0003563 | hsa-miR-557 | GUUUGCACGGGUGGGCCUUGUCU |
| ENST00000376542 | MI0003591 | hsa-miR-584 | UUAUGGUUUGCCUGGGACUGAG |
| ENST00000376542 | MI0003609 | hsa-miR-597 | UGUGUCACUCGAUGACCACUGU |
| ENST00000376542 | MI0003647 | hsa-miR-632 | GUGUCUGCUUCCUGUGGGA |
| ENST00000376542 | MI0003676 | hsa-miR-654-3p | UAUGUCUGCUGACCAUCACCUU |
| ENST00000376542 | MI0005528 | hsa-miR-892a | CACUGUGUCCUUUCUGCGUAG |
| ENST00000376542 | MI0002400 | mmu-miR-465a-3p | GAUCAGGGCCUUUCUAAGUAGA |
| ENST00000376542 | MI0002400 | mmu-miR-465a-5p | UAUUUAGAAUGGCACUGAUGUGA |
| ENST00000376542 | MI0005498 | mmu-miR-465b-5p | UAUUUAGAAUGGUGCUGAUCUG |
| ENST00000376542 | MI0005499 | mmu-miR-465b-5p | UAUUUAGAAUGGUGCUGAUCUG |
| ENST00000376542 | MI0005500 | mmu-miR-465c-5p | UAUUUAGAAUGGCGCUGAUCUG |
| ENST00000376542 | MI0005501 | mmu-miR-465c-5p | UAUUUAGAAUGGCGCUGAUCUG |
| ENST00000376542 | MI0005510 | mmu-miR-466g | AUACAGACACAUGCACACACA |
| ENST00000376542 | MI0004666 | mmu-miR-669b | AGUUUUGUGUGCAUGUGCAUGU |
| ENST00000376542 | MI0004699 | mmu-miR-714 | CGACGAGGGCCGGUCGGUCGC |
Chemicals and Drugs
[
] Comparative Toxicogenomics Database from MDI Biological Lab
Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Gene and Diseases
[
] Gene and Diseases [Data source: CTD]
Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
| Disease Name | Relationship | PubMed |
|---|---|---|
| Breast Neoplasms | inferred via Tamoxifen | 16202921, 16818667, 15668708, 17440819, 17893378, 17261762, 17049068, 16873071, 11161223, 15565566, 17242785 |
| Carcinoma, Hepatocellular | inferred via Tamoxifen | 16924424 |
| Carcinoma, Transitional Cell | inferred via Tamoxifen | 17572228 |
| Endometrial Neoplasms | inferred via Tamoxifen | 16202921, 17893378 |
| Fatty Liver | inferred via Tamoxifen | 14986274 |
| Female Urogenital Diseases | inferred via Tamoxifen | 16709447 |
| Lipidoses | inferred via Tamoxifen | 15342952 |
| Liver Cirrhosis, Experimental | inferred via Tamoxifen | 18564211 |
| Liver Neoplasms | inferred via Tamoxifen | 16684651 |
| Mammary Neoplasms, Experimental | inferred via Tamoxifen | 11731420, 16827153, 14580682 |
| Melanoma | inferred via Tamoxifen | 12393984 |
| Melanoma, Amelanotic | inferred via Tamoxifen | 15990972 |
| Spermatocele | inferred via Tamoxifen | 16709447 |
| Urinary Bladder Neoplasms | inferred via Tamoxifen | 16712894, 17572228 |
| Edema | inferred via pirinixic acid | 12083418 |
| Liver Neoplasms | inferred via pirinixic acid | 15890375 |
| Acne Vulgaris | inferred via Ethinyl Estradiol | 17505938 |
| Adenocarcinoma | inferred via Ethinyl Estradiol | 14692618 |
| Arteriosclerosis | inferred via Ethinyl Estradiol | 11256880 |
| Arthritis, Experimental | inferred via Ethinyl Estradiol | 15885639 |
| Cholestasis | inferred via Ethinyl Estradiol | 17110522, 17333356, 15861022, 11677210, 16105132, 17681005, 16919318 |
| Encephalomyelitis, Autoimmune, Experimental | inferred via Ethinyl Estradiol | 12538720 |
| Fatty Liver | inferred via Ethinyl Estradiol | 15345470 |
| Hypospadias | inferred via Ethinyl Estradiol | 16569931, 16945680 |
| Infertility, Female | inferred via Ethinyl Estradiol | 12013081 |
| Infertility, Male | inferred via Ethinyl Estradiol | 17937319 |
| Panic Disorder | inferred via Ethinyl Estradiol | 11578682 |
| Pruritus | inferred via Ethinyl Estradiol | 16919318, 15861022 |
| Spermatocele | inferred via Ethinyl Estradiol | 16709447 |
| Thrombophilia | inferred via Ethinyl Estradiol | 11994571 |
| Thrombosis | inferred via Ethinyl Estradiol | 15669648 |
| Uterine Neoplasms | inferred via Ethinyl Estradiol | 14692618 |
| Venous Thrombosis | inferred via Ethinyl Estradiol | 15869587 |
Selected Publications
[
] Gene-related publications indexed at PubMed
- [
] Otsuki T, et al. (2005) "Signal sequence and keyword trap in silico for selection of full-length human cDNAs encoding secretion or membrane proteins from oligo-capped cDNA libraries." DNA Res. 12(2):117-126. PMID:16303743 - [
] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039 - [
] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334 - [
] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932 - [
] Deloukas P, et al. (2001) "The DNA sequence and comparative analysis of human chromosome 20." Nature. 414(6866):865-871. PMID:11780052
We have developed an in silico method of selection of human full-length cDNAs encoding secretion or membrane proteins from oligo-capped cDNA libraries. Fullness rates were increased to about 80% by combination of the oligo-capping method and ATGpr, software for prediction of translation start point and the coding potential. Then, using 5'-end single-pass sequences, cDNAs having the signal sequence were selected by PSORT ('signal sequence trap'). We also applied 'secretion or membrane protein-related keyword trap' based on the result of BLAST search against the SWISS-PROT database for the cDNAs which could not be selected by PSORT. Using the above procedures, 789 cDNAs were primarily selected and subjected to full-length sequencing, and 334 of these cDNAs were finally selected as novel. Most of the cDNAs (295 cDNAs: 88.3%) were predicted to encode secretion or membrane proteins. In particular, 165(80.5%) of the 205 cDNAs selected by PSORT were predicted to have signal sequences, while 70 (54.2%) of the 129 cDNAs selected by 'keyword trap' preserved the secretion or membrane protein-related keywords. Many important cDNAs were obtained, including transporters, receptors, and ligands, involved in significant cellular functions. Thus, an efficient method of selecting secretion or membrane protein-encoding cDNAs was developed by combining the above four procedures.
As a base for human transcriptome and functional genomics, we created the "full-length long Japan" (FLJ) collection of sequenced human cDNAs. We determined the entire sequence of 21,243 selected clones and found that 14,490 cDNAs (10,897 clusters) were unique to the FLJ collection. About half of them (5,416) seemed to be protein-coding. Of those, 1,999 clusters had not been predicted by computational methods. The distribution of GC content of nonpredicted cDNAs had a peak at approximately 58% compared with a peak at approximately 42%for predicted cDNAs. Thus, there seems to be a slight bias against GC-rich transcripts in current gene prediction procedures. The rest of the cDNAs unique to the FLJ collection (5,481) contained no obvious open reading frames (ORFs) and thus are candidate noncoding RNAs. About one-fourth of them (1,378) showed a clear pattern of splicing. The distribution of GC content of noncoding cDNAs was narrow and had a peak at approximately 42%, relatively low compared with that of protein-coding cDNAs.
The National Institutes of Health's Mammalian Gene Collection (MGC) project was designed to generate and sequence a publicly accessible cDNA resource containing a complete open reading frame (ORF) for every human and mouse gene. The project initially used a random strategy to select clones from a large number of cDNA libraries from diverse tissues. Candidate clones were chosen based on 5'-EST sequences, and then fully sequenced to high accuracy and analyzed by algorithms developed for this project. Currently, more than 11,000 human and 10,000 mouse genes are represented in MGC by at least one clone with a full ORF. The random selection approach is now reaching a saturation point, and a transition to protocols targeted at the missing transcripts is now required to complete the mouse and human collections. Comparison of the sequence of the MGC clones to reference genome sequences reveals that most cDNA clones are of very high sequence quality, although it is likely that some cDNAs may carry missense variants as a consequence of experimental artifact, such as PCR, cloning, or reverse transcriptase errors. Recently, a rat cDNA component was added to the project, and ongoing frog (Xenopus) and zebrafish (Danio) cDNA projects were expanded to take advantage of the high-throughput MGC pipeline.
The National Institutes of Health Mammalian Gene Collection (MGC) Program is a multiinstitutional effort to identify and sequence a cDNA clone containing a complete ORF for each human and mouse gene. ESTs were generated from libraries enriched for full-length cDNAs and analyzed to identify candidate full-ORF clones, which then were sequenced to high accuracy. The MGC has currently sequenced and verified the full ORF for a nonredundant set of >9,000 human and >6,000 mouse genes. Candidate full-ORF clones for an additional 7,800 human and 3,500 mouse genes also have been identified. All MGC sequences and clones are available without restriction through public databases and clone distribution networks (see http:mgc.nci.nih.gov).
The finished sequence of human chromosome 20 comprises 59,187,298 base pairs (bp) and represents 99.4% of the euchromatic DNA. A single contig of 26 megabases (Mb) spans the entire short arm, and five contigs separated by gaps totalling 320 kb span the long arm of this metacentric chromosome. An additional 234,339 bp of sequence has been determined within the pericentromeric region of the long arm. We annotated 727 genes and 168 pseudogenes in the sequence. About 64% of these genes have a 5' and a 3' untranslated region and a complete open reading frame. Comparative analysis of the sequence of chromosome 20 to whole-genome shotgun-sequence data of two other vertebrates, the mouse Mus musculus and the puffer fish Tetraodon nigroviridis, provides an independent measure of the efficiency of gene annotation, and indicates that this analysis may account for more than 95% of all coding exons and almost all genes.

