ABP1 | GeneID:26 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 26 Official Symbol ABP1
Locus N/A Gene Type protein-coding
Synonyms ABP; AOC1; DAO; DAO1; KAO
Full Name amiloride binding protein 1 (amine oxidase (copper-containing))
Description amiloride binding protein 1 (amine oxidase (copper-containing))
Chromosome 7q34-q36
Also Known As amiloride binding protein 1; amiloride-binding protein; amiloride-binding protein-1; amiloride-sensitive amine oxidase; diamine oxidase; histaminase; kidney amine oxidase
Summary This gene encodes a membrane glycoprotein that is expressed in many epithelium-rich and/or hematopoietic tissues and oxidatively deaminates putrescine and histamine. The protein may play a role in controlling the level of histamine and/or putrescine in these tissues. It also binds to and is inhibited by amiloride, a diuretic that acts by closing epithelial sodium ion channels. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 68159

ID Symbol Protein Species
GeneID:26 ABP1 NP_001082.2 Homo sapiens
GeneID:65029 Abp1 NP_075224.1 Rattus norvegicus
GeneID:76507 Abp1 NP_083914.1 Mus musculus
GeneID:463895 ABP1 XP_001136583.1 Pan troglodytes
GeneID:475536 ABP1 XP_532759.1 Canis lupus familiaris
GeneID:509751 ABP1 NP_001029533.1 Bos taurus
GeneID:555401 abp1 NP_001071066.1 Danio rerio
GeneID:5049146 MGG_13291 XP_001404794.1 Magnaporthe grisea

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 scbt ABP1 ABP1 Antibody / ABP1 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABP1 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABP1 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005576 Component extracellular region
GO:0005615 Component extracellular space
GO:0005777 Component peroxisome
GO:0008131 Function amine oxidase activity
GO:0005509 Function calcium ion binding
GO:0005507 Function copper ion binding
GO:0008201 Function heparin binding
GO:0016491 Function oxidoreductase activity
GO:0048038 Function quinone binding
GO:0009308 Process cellular amine metabolic process
GO:0055114 Process oxidation reduction

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001091  UCSC Browser NP_001082

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000360937 MI0000065 hsa-let-7d* CUAUACGACCUGCUGCCUUUCU
ENST00000360937 MI0005544 hsa-miR-147b GUGUGCGGAAAUGCUUCUGCUA
ENST00000360937 MI0000478 hsa-miR-149* AGGGAGGGACGGGGGCUGUGC
ENST00000360937 MI0000289 hsa-miR-181a* ACCAUCGACCGUUGAUUGUACC
ENST00000360937 MI0000482 hsa-miR-185* AGGGGCUGGCUUUCCUCUGGUC
ENST00000360937 MI0000072 hsa-miR-18a* ACUGCCCUAAGUGCUCCUUCUGG
ENST00000360937 MI0000487 hsa-miR-193a-5p UGGGUCUUUGCGGGCGAGAUGA
ENST00000360937 MI0000732 hsa-miR-194* CCAGUGGGGCUGCUGUUAUCUG
ENST00000360937 MI0003130 hsa-miR-202 AGAGGUAUAGGGCAUGGGAA
ENST00000360937 MI0000079 hsa-miR-23a* GGGGUUCCUGGGGAUGGGAUUU
ENST00000360937 MI0000084 hsa-miR-26b* CCUGUUCUCCAUUACUUGGCUC
ENST00000360937 MI0000085 hsa-miR-27a UUCACAGUGGCUAAGUUCCGC
ENST00000360937 MI0000440 hsa-miR-27b UUCACAGUGGCUAAGUUCUGC
ENST00000360937 MI0000813 hsa-miR-324-3p ACUGCCCCAGGUGCUGCUGG
ENST00000360937 MI0000815 hsa-miR-339-5p UCCCUGUCCUCCAGGAGCUCACG
ENST00000360937 MI0000826 hsa-miR-346 UGUCUGCCCGCAUGCCUGCCUCU
ENST00000360937 MI0002469 hsa-miR-485-3p GUCAUACACGGCUCUCCUCUCU
ENST00000360937 MI0003140 hsa-miR-512-3p AAGUGCUGUCAUAGCUGAGGUC
ENST00000360937 MI0003141 hsa-miR-512-3p AAGUGCUGUCAUAGCUGAGGUC
ENST00000360937 MI0003180 hsa-miR-516a-3p UGCUUCCUUUCAGAGGGU
ENST00000360937 MI0003181 hsa-miR-516a-3p UGCUUCCUUUCAGAGGGU
ENST00000360937 MI0003180 hsa-miR-516a-5p UUCUCGAGGAAAGAAGCACUUUC
ENST00000360937 MI0003181 hsa-miR-516a-5p UUCUCGAGGAAAGAAGCACUUUC
ENST00000360937 MI0003159 hsa-miR-518c* UCUCUGGAGGGAAGCACUUUCUG
ENST00000360937 MI0003686 hsa-miR-542-5p UCGGGGAUCAUCAUGUCACGAGA
ENST00000360937 MI0003592 hsa-miR-585 UGGGCGUAUCUGUAUGCUA
ENST00000360937 MI0003608 hsa-miR-596 AAGCCUGCCCGGCUCCUCGGG
ENST00000360937 MI0003626 hsa-miR-613 AGGAAUGUUCCUUCUUUGCC
ENST00000360937 MI0003628 hsa-miR-615-5p GGGGGUCCCCGGUGCUCGGAUC
ENST00000360937 MI0003647 hsa-miR-632 GUGUCUGCUUCCUGUGGGA
ENST00000360937 MI0003652 hsa-miR-637 ACUGGGGGCUUUCGGGCUCUGCGU
ENST00000360937 MI0003659 hsa-miR-644 AGUGUGGCUUUCUUAGAGC
ENST00000360937 MI0003760 hsa-miR-671-3p UCCGGUUCUCAGGGCUCCACC
ENST00000360937 MI0003760 hsa-miR-671-5p AGGAAGCCCUGGAGGGGCUGGAG
ENST00000360937 MI0002406 mmu-miR-471 UACGUAGUAUAGUGCUUUUCAC
ENST00000360937 MI0004523 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENST00000360937 MI0004667 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENST00000360937 MI0004668 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Allylamine
  • Allylamine affects the expression of ABP1 mRNA
15910882
cobaltous chloride
  • cobaltous chloride binds to ABP1 protein
16842785
cupric chloride
  • cupric chloride results in increased activity of ABP1 protein
16842785
Diethylstilbestrol
  • Diethylstilbestrol results in increased expression of ABP1 mRNA
15289156
Estradiol
  • Estradiol results in increased expression of ABP1 mRNA
15289156
Genistein
  • Genistein results in increased expression of ABP1 mRNA
15289156
Hydralazine
  • [Hydralazine co-treated with Valproic Acid] results in increased expression of ABP1 mRNA
17183730
nickel chloride
  • nickel chloride does not bind to ABP1 protein
16842785
nickel sulfate
  • nickel sulfate results in increased expression of ABP1 mRNA
16780908
sodium arsenate
  • sodium arsenate results in decreased expression of ABP1 mRNA
12727804
sodium arsenite
  • sodium arsenite results in decreased expression of ABP1 mRNA
12727804
Valproic Acid
  • [Hydralazine co-treated with Valproic Acid] results in increased expression of ABP1 mRNA
17183730
Zinc
  • Zinc does not bind to ABP1 protein
16842785
zinc chloride
  • zinc chloride does not bind to ABP1 protein
16842785

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Acrodermatitis inferred via Zinc 17190629, 17202136, 16889938
Alzheimer Disease inferred via Zinc 17119284, 16580781, 16410023, 16325427
Anemia, Sickle Cell inferred via Zinc 16916123
Asthma inferred via Zinc 17085522
Brain Injuries inferred via Zinc 17109824
Carcinoma, Squamous Cell inferred via Zinc 16543248
Cardiovascular Diseases inferred via Zinc 16936243
Diabetes Mellitus inferred via Zinc 16479319
Esophageal Neoplasms inferred via Zinc 16543248
Gastritis inferred via Zinc 17241300
Growth Disorders inferred via Zinc 17217573
Heart Failure inferred via Zinc 17162251
Heart Injuries inferred via Zinc 17074742
Helicobacter Infections inferred via Zinc 17241300
Hepatolenticular Degeneration inferred via Zinc 17276780
Ischemia inferred via Zinc 16584753
Kidney Diseases inferred via Zinc 16960431
Kidney Failure, Chronic inferred via Zinc 16518626
Mammary Neoplasms, Experimental inferred via Zinc 12773700
Pre-Eclampsia inferred via Zinc 17114810
Prostatic Neoplasms inferred via Zinc 12429649, 16517595, 16700911, 16606632
Retinal Degeneration inferred via Zinc 16584753
Tongue Neoplasms inferred via Zinc 16543248
Dystonia inferred via Valproic Acid 1851702
Fatty Liver inferred via Valproic Acid 14986274
Leukemia, Myeloid, Acute inferred via Valproic Acid 16294345
Migraine Disorders inferred via Valproic Acid 18765137, 18803445
Pseudolymphoma inferred via Valproic Acid 12752131
Seizures inferred via Valproic Acid 11738929
Unverricht-Lundborg Syndrome inferred via Valproic Acid 3119515
Adrenal Gland Neoplasms inferred via sodium arsenite 15276417
Adrenocortical Adenoma inferred via sodium arsenite 16712894
Carcinoma, Hepatocellular inferred via sodium arsenite 15276417, 16507464
Carcinoma, Squamous Cell inferred via sodium arsenite 18572023
Genital Neoplasms, Female inferred via sodium arsenite 16452187
Hodgkin Disease inferred via sodium arsenite 12676792
Liver Neoplasms inferred via sodium arsenite 15276417, 16712894
Lung Neoplasms inferred via sodium arsenite 15276417, 17077188, 16712894
Melanoma inferred via sodium arsenite 16487513
Neoplasms inferred via sodium arsenite 11559025
Neural Tube Defects inferred via sodium arsenite 12854658
Ovarian Neoplasms inferred via sodium arsenite 15276417
Prostatic Neoplasms inferred via sodium arsenite 16039940
Skin Neoplasms inferred via sodium arsenite 18572023
Spinal Dysraphism inferred via sodium arsenite 12854658
Urinary Bladder Neoplasms inferred via sodium arsenite 11723127, 16452187, 16712894
Uterine Cervical Neoplasms inferred via sodium arsenite 11813266
Vascular Diseases inferred via sodium arsenite 17056641
Neural Tube Defects inferred via sodium arsenate 11749123
Dermatitis, Allergic Contact inferred via nickel sulfate 16780908
Hypertension, Pregnancy-Induced inferred via Hydralazine 16612254
Breast Neoplasms inferred via Genistein 17200150, 16873071, 16541309
Carcinoma, Hepatocellular inferred via Genistein 16924424
Cardiovascular Diseases inferred via Genistein 16332659
Colonic Neoplasms inferred via Genistein 17182828
Diabetes Mellitus, Type 2 inferred via Genistein 16647724
Endometrial Hyperplasia inferred via Genistein 16402032
Glioblastoma inferred via Genistein 16598420
Liver Cirrhosis, Experimental inferred via Genistein 17823541
Mammary Neoplasms, Experimental inferred via Genistein 14578162, 12929590
Myocardial Infarction inferred via Genistein 17141266
Myocardial Reperfusion Injury inferred via Genistein 17141266
Osteoporosis, Postmenopausal inferred via Genistein 16169203
Prostatic Neoplasms inferred via Genistein 16925846, 15378649, 15256057
Breast Neoplasms inferred via Estradiol 17289903, 12948864, 14630087, 17261762, 18497071, 17018787
Candidiasis, Vulvovaginal inferred via Estradiol 16111702
Carcinoma, Hepatocellular inferred via Estradiol 16924424
Herpes Genitalis inferred via Estradiol 15709030
Hot Flashes inferred via Estradiol 17088409
Insulin Resistance inferred via Estradiol 16393666, 16627594
Kidney Diseases inferred via Estradiol 15618244
Kidney Neoplasms inferred via Estradiol 15610895
Liver Cirrhosis, Experimental inferred via Estradiol 14716833, 14659978
Mammary Neoplasms, Experimental inferred via Estradiol 17203775, 11408345, 16891317, 11807958
Myocardial Reperfusion Injury inferred via Estradiol 16810080
Neovascularization, Pathologic inferred via Estradiol 17289903
Prostatic Neoplasms inferred via Estradiol 16740699
Amyloidosis inferred via Diethylstilbestrol 15469931
Breast Neoplasms inferred via Diethylstilbestrol 15324884, 17129689
Carcinoma, Hepatocellular inferred via Diethylstilbestrol 16924424, 15948411
Cryptorchidism inferred via Diethylstilbestrol 12952375, 16002989
Endometrial Hyperplasia inferred via Diethylstilbestrol 16402032
Endometrial Neoplasms inferred via Diethylstilbestrol 15700306, 16804899
Female Urogenital Diseases inferred via Diethylstilbestrol 16513791, 16002989, 16534752, 16611131, 15751030
Genital Neoplasms, Female inferred via Diethylstilbestrol 16452187
Hyperplasia inferred via Diethylstilbestrol 12960047, 14722030
Hypospadias inferred via Diethylstilbestrol 16002989
Infertility inferred via Diethylstilbestrol 15036965
Kidney Neoplasms inferred via Diethylstilbestrol 15003126, 16762066, 14681315
Liver Neoplasms inferred via Diethylstilbestrol 16712894, 15890375
Lupus Nephritis inferred via Diethylstilbestrol 15166399
Lymphoma inferred via Diethylstilbestrol 15700306
Male Urogenital Diseases inferred via Diethylstilbestrol 16002989
Neoplasms inferred via Diethylstilbestrol 15313581
Pituitary Diseases inferred via Diethylstilbestrol 14722030
Pituitary Neoplasms inferred via Diethylstilbestrol 15687265, 16977796
Prostatic Neoplasms inferred via Diethylstilbestrol 15846301, 17136230, 15046698
Spermatocele inferred via Diethylstilbestrol 16709447, 16002989
Urinary Bladder Neoplasms inferred via Diethylstilbestrol 16712894, 16452187
Uterine Cervical Neoplasms inferred via Diethylstilbestrol 16175088
Uterine Diseases inferred via Diethylstilbestrol 14652134
Uterine Neoplasms inferred via Diethylstilbestrol 15809267, 16690809
Vaginal Neoplasms inferred via Diethylstilbestrol 16513791, 16002989

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Agundez JA, et al. (2008) "Nonsynonymous polymorphisms of histamine-metabolising enzymes in patients with Parkinson's disease." Neuromolecular Med. 10(1):10-16. PMID:17985251
  2. [ + ] Ayuso P, et al. (2007) "Genetic variability of human diamine oxidase: occurrence of three nonsynonymous polymorphisms and study of their effect on serum enzyme activity." Pharmacogenet Genomics. 17(9):687-693. PMID:17700358
  3. [ + ] Garcia-Martin E, et al. (2007) "Polymorphisms of histamine-metabolizing enzymes and clinical manifestations of asthma and allergic rhinitis." Clin Exp Allergy. 37(8):1175-1182. PMID:17651147
  4. [ + ] Garcia-Martin E, et al. (2006) "Severity of ulcerative colitis is associated with a polymorphism at diamine oxidase gene but not at histamine N-methyltransferase gene." World J Gastroenterol. 12(4):615-620. PMID:16489678
  5. [ + ] Boomsma F, et al. (2005) "Association between plasma activities of semicarbazide-sensitive amine oxidase and angiotensin-converting enzyme in patients with type 1 diabetes mellitus." Diabetologia. 48(5):1002-1007. PMID:15830186
  6. [ + ] Petersen J, et al. (2005) "Characterisation of functional polymorphisms of the human diamine oxidase gene." Inflamm Res. 54 Suppl 1():S58-S59. PMID:15928835
  7. [ + ] Conklin DJ, et al. (2004) "Vasoactive effects of methylamine in isolated human blood vessels: role of semicarbazide-sensitive amine oxidase, formaldehyde, and hydrogen peroxide." Am J Physiol Heart Circ Physiol. 286(2):H667-H676. PMID:14715500
  8. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  9. [ + ] Olive M, et al. (2004) "Overexpression of semicarbazide-sensitive amine oxidase in human myopathies." Muscle Nerve. 29(2):261-266. PMID:14755492
  10. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  11. [ + ] Petersen J, et al. (2003) "Analysis of genetic polymorphisms of enzymes involved in histamine metabolism." Inflamm Res. 52 Suppl 1():S69-S70. PMID:12755416
  12. [ + ] Scherer SW, et al. (2003) "Human chromosome 7: DNA sequence and biology." Science. 300(5620):767-772. PMID:12690205
  13. [ + ] Rogers MS, et al. (2002) "Cervical intraepithelial neoplasia is associated with increased polyamine oxidase and diamine oxidase concentrations in cervical mucus." Gynecol Oncol. 84(3):383-387. PMID:11855874
  14. [ + ] Schafer DA, et al. (2002) "Dynamin2 and cortactin regulate actin assembly and filament organization." Curr Biol. 12(21):1852-1857. PMID:12419186
  15. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  16. [ + ] Brew OB, et al. (2001) "Localisation of mRNAs for diamine oxidase and histamine receptors H1 and H2, at the feto-maternal interface of human pregnancy." Inflamm Res. 50(9):449-452. PMID:11603849
  17. [ + ] Tsujikawa T, et al. (1999) "Changes in serum diamine oxidase activity during chemotherapy in patients with hematological malignancies." Cancer Lett. 147(1-2):195-198. PMID:10660106
  18. [ + ] Jarisch R, et al. (1996) "Wine and headache." Int Arch Allergy Immunol. 110(1):7-12. PMID:8645981
  19. [ + ] Zhang X, et al. (1995) "cDNA sequences of variant forms of human placenta diamine oxidase." Biochem Genet. 33(7-8):261-268. PMID:8595053
  20. [ + ] Seiler N, et al. (1995) "Characterization of amine oxidase activities in macrophages from human peripheral blood." Biochem Cell Biol. 73(5-6):275-281. PMID:8829374
  21. [ + ] Novotny WF, et al. (1994) "Diamine oxidase is the amiloride-binding protein and is inhibited by amiloride analogues." J Biol Chem. 269(13):9921-9925. PMID:8144586
  22. [ + ] Baenziger NL, et al. (1994) "Histamine degradative uptake by cultured human pulmonary vascular endothelial cells utilizes an inflammatory cell diamine oxidase." J Biol Chem. 269(52):32858-32864. PMID:7806511
  23. [ + ] Baenziger NL, et al. (1994) "An environmentally regulated receptor for diamine oxidase modulates human endothelial cell/fibroblast histamine degradative uptake." J Biol Chem. 269(21):14892-14898. PMID:8195119
  24. [ + ] Chassande O, et al. (1994) "The human gene for diamine oxidase, an amiloride binding protein. Molecular cloning, sequencing, and characterization of the promoter." J Biol Chem. 269(20):14484-14489. PMID:8182053
  25. [ + ] Abe Y, et al. (1993) "Histamine content, synthesis and degradation in nasal mucosa and lung of guinea-pigs treated with toluene diisocyanate (TDI)." Clin Exp Allergy. 23(6):512-517. PMID:8396495
  26. [ + ] Fukui K, et al. (1992) "Molecular cloning and chromosomal localization of a human gene encoding D-amino-acid oxidase." J Biol Chem. 267(26):18631-18638. PMID:1356107
  27. [ + ] D'Agostino L, et al. (1991) "Plasma postheparin diamine oxidase in patients with small intestinal lymphoma." Cancer. 67(2):511-515. PMID:1898707
  28. [ + ] Barbry P, et al. (1990) "Localization of the gene for amiloride binding protein on chromosome 7 and RFLP analysis in cystic fibrosis families." Hum Genet. 85(6):587-589. PMID:2227949
  29. [ + ] Barbry P, et al. (1990) "Human kidney amiloride-binding protein: cDNA structure and functional expression." Proc Natl Acad Sci U S A. 87(19):7347-7351. PMID:2217167