ABI3BP | GeneID:25890 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 25890 Official Symbol ABI3BP
Locus N/A Gene Type protein-coding
Synonyms FLJ41743; FLJ41754; NESHBP; TARSH
Full Name ABI family, member 3 (NESH) binding protein
Description ABI family, member 3 (NESH) binding protein
Chromosome 3q12
Also Known As ABI gene family, member 3 (NESH) binding protein; target of Nesh-SH3
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 105358

ID Symbol Protein Species
GeneID:25890 ABI3BP NP_056244.2 Homo sapiens
GeneID:320712 Abi3bp NP_001014422.1 Mus musculus
GeneID:478544 ABI3BP XP_535721.2 Canis lupus familiaris
GeneID:538604 ABI3BP XP_581418.3 Bos taurus

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab68612 ABI3BP antibody (ab68612); Mouse polyclonal to ABI3BP
2 abnova H00025890-M15 ABI3BP monoclonal antibody (M15), clone 2B8; Mouse monoclonal antibody raised against a partial recombinant ABI3BP.

Exon, Intron and UTRs

Exon, Intron and UTRs of ABI3BP Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABI3BP Gene

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_015429  UCSC Browser NP_056244

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000284322 MI0000463 hsa-miR-153 UUGCAUAGUCACAAAAGUGAUC
ENST00000284322 MI0000464 hsa-miR-153 UUGCAUAGUCACAAAAGUGAUC
ENST00000284322 MI0000806 hsa-miR-337-3p CUCCUAUAUGAUGCCUUUCUUC
ENST00000284322 MI0000777 hsa-miR-369-3p AAUAAUACAUGGUUGAUCUUU
ENST00000284322 MI0001735 hsa-miR-409-3p GAAUGUUGCUCGGUGAACCCCU
ENST00000284322 MI0003675 hsa-miR-411 UAGUAGACCGUAUAGCGUACG
ENST00000284322 MI0003195 hsa-miR-508-3p UGAUUGUAGCCUUUUGGAGUAGA
ENST00000284322 MI0003161 hsa-miR-517a AUCGUGCAUCCCUUUAGAGUGU
ENST00000284322 MI0003165 hsa-miR-517b UCGUGCAUCCCUUUAGAGUGUU
ENST00000284322 MI0003174 hsa-miR-517c AUCGUGCAUCCUUUUAGAGUGU
ENST00000284322 MI0003574 hsa-miR-568 AUGUAUAAAUGUAUACACAC
ENST00000284322 MI0003580 hsa-miR-573 CUGAAGUGAUGUGUAACUGAUCAG
ENST00000284322 MI0005548 mmu-miR-878-5p UAUCUAGUUGGAUGUCAAGACA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Carbon Tetrachloride
  • Carbon Tetrachloride results in decreased expression of ABI3BP mRNA
17484886

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 16050911, 15673190, 16011737, 15700767, 16124888, 16227642, 10355542, 16097048
Fatty Liver inferred via Carbon Tetrachloride 16045604, 16239168, 12795759, 61145, 12631006, 17595544, 15959796
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 11566570, 16177239, 16227642, 15027814, 15968718, 15998439
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 16943688, 16221502, 16239168, 17334410
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 15925388, 17525996, 17557913, 18156304, 16033810, 17565644, 17869086, 17708605, 12667390, 14748882, 13678700, 15818738, 17631135, 18339082, 18429990, 12546737, 18006644, 18481824, 15057751, 12586293, 18054572, 10355542, 18166357, 17922224, 18420326, 15876570, 12445421, 12445418, 15959796, 12898905, 18317297, 18376398, 12389079, 18187930, 18210741, 16015684, 12741479, 14724832, 18472094, 15931870, 17698563, 15893842, 12958196, 17640975, 18412020, 17714472, 14512876, 12609069, 17761835, 14620537, 18472332, 14716833, 16136751, 17481882, 17900296, 15123356, 16011737, 18251166, 17823541, 17944888, 18395914, 18279442, 16027843, 15996030, 16097048, 15673190, 12649538, 17721639, 18277467, 18205269, 14716496, 15730626, 12632514, 15052691, 12632512, 17766677, 18418968, 12666154, 16638106, 18395095, 17976157, 17805973, 16248980, 16116963
Liver Diseases inferred via Carbon Tetrachloride 16246199, 15720792, 16964402, 17285989, 15830285
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
ABI3 ABI3 / ABI3BP Two-hybrid Matsuda S (2001)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Wakoh T, et al. (2009) "Implication of p53-dependent cellular senescence related gene, TARSH in tumor suppression." Biochem Biophys Res Commun. 380(4):807-812. PMID:19338757
  2. [ + ] Latini FR, et al. (2008) "Re-expression of ABI3-binding protein suppresses thyroid tumor growth by promoting senescence and inhibiting invasion." Endocr Relat Cancer. 15(3):787-799. PMID:18559958
  3. [ + ] Terauchi K, et al. (2006) "Cancer-associated loss of TARSH gene expression in human primary lung cancer." J Cancer Res Clin Oncol. 132(1):28-34. PMID:16205947
  4. [ + ] Kimura K, et al. (2006) "Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes." Genome Res. 16(1):55-65. PMID:16344560
  5. [ + ] Uekawa N, et al. (2005) "Expression of TARSH gene in MEFs senescence and its potential implication in human lung cancer." Biochem Biophys Res Commun. 329(3):1031-1038. PMID:15752759
  6. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  7. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  8. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  9. [ + ] Matsuda S, et al. (2001) "Cloning and sequencing of a novel human gene that encodes a putative target protein of Nesh-SH3." J Hum Genet. 46(8):483-486. PMID:11501947