Abcc9 | GeneID:25560 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 25560 Official Symbol Abcc9
Locus N/A Gene Type protein-coding
Synonyms Sur2
Full Name ATP-binding cassette, sub-family C (CFTR/MRP), member 9
Description ATP-binding cassette, sub-family C (CFTR/MRP), member 9
Chromosome 4q44
Also Known As Sulfonylurea receptor 2
Summary ATP-sensitive potassium channel subunit that confers ATP sensitivity and acts as receptor for sulfonylurea; may play a role in mesangial cell contractility in response to calcium ion transients [RGD]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 56521

ID Symbol Protein Species
GeneID:10060 ABCC9 NP_064693.2 Homo sapiens
GeneID:20928 Abcc9 NP_035641.1 Mus musculus
GeneID:25560 Abcc9 NP_037172.2 Rattus norvegicus
GeneID:34350 Sur NP_477472.1 Drosophila melanogaster
GeneID:465338 ABCC9 XP_001149571.1 Pan troglodytes
GeneID:486638 ABCC9 XP_852746.1 Canis lupus familiaris
GeneID:522913 ABCC9 XP_601202.3 Bos taurus
GeneID:561160 abcc9 NP_001025325.1 Danio rerio

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0008282 Component ATP-sensitive potassium channel complex
GO:0005624 Component membrane fraction
GO:0005739 Component mitochondrion
GO:0005886 Component plasma membrane
GO:0030017 Component sarcomere
GO:0030315 Component T-tubule
GO:0008144 Function drug binding
GO:0005267 Function potassium channel activity
GO:0004872 Function receptor activity
GO:0008281 Function sulfonylurea receptor activity
GO:0019905 Function syntaxin binding
GO:0051607 Process defense response to virus
GO:0042493 Process response to drug
GO:0006932 Process substrate-bound cell migration, cell contraction

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_013040  UCSC Browser NP_037172

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000055540 MI0003197 hsa-miR-510 UACUCAGGAGAGUGGCAAUCAC
ENSRNOT00000055540 MI0003140 hsa-miR-512-3p AAGUGCUGUCAUAGCUGAGGUC
ENSRNOT00000055540 MI0003141 hsa-miR-512-3p AAGUGCUGUCAUAGCUGAGGUC
ENSRNOT00000055540 MI0003140 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENSRNOT00000055540 MI0003141 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENSRNOT00000055540 MI0003596 hsa-miR-548b-3p CAAGAACCUCAGUUGCUUUUGU
ENSRNOT00000055540 MI0003563 hsa-miR-557 GUUUGCACGGGUGGGCCUUGUCU
ENSRNOT00000055540 MI0003591 hsa-miR-584 UUAUGGUUUGCCUGGGACUGAG
ENSRNOT00000055540 MI0003682 hsa-miR-658 GGCGGAGGGAAGUAGGUCCGUUGGU
ENSRNOT00000055540 MI0004690 mmu-miR-706 AGAGAAACCCUGUCUCAAAAAA
ENSRNOT00000055540 MI0004693 mmu-miR-709 GGAGGCAGAGGCAGGAGGA
ENSRNOT00000055540 MI0000827 rno-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSRNOT00000055540 MI0000828 rno-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSRNOT00000055540 MI0000601 rno-let-7d AGAGGUAGUAGGUUGCAUAGUU
ENSRNOT00000055540 MI0000832 rno-let-7e UGAGGUAGGAGGUUGUAUAGUU
ENSRNOT00000055540 MI0000942 rno-miR-200c UAAUACUGCCGGGUAAUGAUGG
ENSRNOT00000055540 MI0000638 rno-miR-20a* ACUGCAUUACGAGCACUUACA
ENSRNOT00000055540 MI0000967 rno-miR-296 GAGGGUUGGGUGGAGGCUCUCC
ENSRNOT00000055540 MI0000620 rno-miR-339-5p UCCCUGUCCUCCAGGAGCUCACG
ENSRNOT00000055540 MI0003544 rno-miR-376b-5p GUGGAUAUUCCUUCUAUGGUUA
ENSRNOT00000055540 MI0003543 rno-miR-376c AACAUAGAGGAAAUUUCACGU
ENSRNOT00000055540 MI0001643 rno-miR-429 UAAUACUGUCUGGUAAUGCCGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

AB045281   AF019628   AF087838   D83598   NM_013040  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

AAC24758   AAC36347   AAC62755   AAC62756   BAA12020   BAA97256   EDM01477   EDM01485   NP_037172   Q63563   Q9JJ67   Q9QWP5   Q9QWX3  

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Zhou M, et al. (2008) "Localization of the sulphonylurea receptor subunits, SUR2A and SUR2B, in rat renal tubular epithelium." Tohoku J Exp Med. 214(3):247-256. PMID:18323694
  2. [ + ] Blanco-Rivero J, et al. (2008) "Decreased expression of aortic KIR6.1 and SUR2B in hypertension does not correlate with changes in the functional role of K(ATP) channels." Eur J Pharmacol. 587(1-3):204-208. PMID:18471810
  3. [ + ] Shi Y, et al. (2008) "cAMP-dependent protein kinase phosphorylation produces interdomain movement in SUR2B leading to activation of the vascular KATP channel." J Biol Chem. 283(12):7523-7530. PMID:18198173
  4. [ + ] Yang Y, et al. (2008) "PKA-dependent activation of the vascular smooth muscle isoform of KATP channels by vasoactive intestinal polypeptide and its effect on relaxation of the mesenteric resistance artery." Biochim Biophys Acta. 1778(1):88-96. PMID:17942071
  5. [ + ] Zhou M, et al. (2007) "Localization of sulfonylurea receptor subunits, SUR2A and SUR2B, in rat heart." J Histochem Cytochem. 55(8):795-804. PMID:17438353
  6. [ + ] Tammaro P, et al. (2007) "A mutation in the ATP-binding site of the Kir6.2 subunit of the KATP channel alters coupling with the SUR2A subunit." J Physiol. 584(Pt 3):743-753. PMID:17855752
  7. [ + ] Tammaro P, et al. (2007) "The Kir6.2-F333I mutation differentially modulates KATP channels composed of SUR1 or SUR2 subunits." J Physiol. 581(Pt 3):1259-1269. PMID:17395632
  8. [ + ] Jin JY, et al. (2007) "Uncoupling by (--)-epigallocatechin-3-gallate of ATP-sensitive potassium channels from phosphatidylinositol polyphosphates and ATP." Pharmacol Res. 56(3):237-247. PMID:17656102
  9. [ + ] Hosy E, et al. (2007) "Remodelling of the SUR-Kir6.2 interface of the KATP channel upon ATP binding revealed by the conformational blocker rhodamine 123." J Physiol. 582(Pt 1):27-39. PMID:17510180
  10. [ + ] Jons T, et al. (2006) "K+-ATP-channel-related protein complexes: potential transducers in the regulation of epithelial tight junction permeability." J Cell Sci. 119(Pt 15):3087-3097. PMID:16820413
  11. [ + ] Kang Y, et al. (2006) "Syntaxin-1A actions on sulfonylurea receptor 2A can block acidic pH-induced cardiac K(ATP) channel activation." J Biol Chem. 281(28):19019-19028. PMID:16672225
  12. [ + ] Cuong DV, et al. (2005) "Subunit composition of ATP-sensitive potassium channels in mitochondria of rat hearts." Mitochondrion. 5(2):121-133. PMID:16050978
  13. [ + ] Morrissey A, et al. (2005) "Immunolocalization of KATP channel subunits in mouse and rat cardiac myocytes and the coronary vasculature." BMC Physiol. 5(1):1. PMID:15647111
  14. [ + ] Gao M, et al. (2005) "Iptakalim, opener of K(ATP), reverses the enhanced expression of genes encoding K(ATP) subunits in spontaneously hypertensive rats." Life Sci. 77(22):2743-2751. PMID:15964031
  15. [ + ] Rainbow RD, et al. (2004) "Proximal C-terminal domain of sulphonylurea receptor 2A interacts with pore-forming Kir6 subunits in KATP channels." Biochem J. 379(Pt 1):173-181. PMID:14672537
  16. [ + ] Kang Y, et al. (2004) "Syntaxin-1A inhibits cardiac KATP channels by its actions on nucleotide binding folds 1 and 2 of sulfonylurea receptor 2A." J Biol Chem. 279(45):47125-47131. PMID:15339904
  17. [ + ] Li L, et al. (2003) "Differential expression of Kir6.1 and SUR2B mRNAs in the vasculature of various tissues in rats." J Membr Biol. 196(1):61-69. PMID:14724757
  18. [ + ] Santa N, et al. (2003) "ATP-sensitive potassium channels mediate dilatation of basilar artery in response to intracellular acidification in vivo." Stroke. 34(5):1276-1280. PMID:12677015
  19. [ + ] Konstas AA, et al. (2002) "Intrinsic sensitivity of Kir1.1 (ROMK) to glibenclamide in the absence of SUR2B. Implications for the identity of the renal ATP-regulated secretory K+ channel." J Biol Chem. 277(24):21346-21351. PMID:11927600
  20. [ + ] Cao K, et al. (2002) "Molecular basis of ATP-sensitive K+ channels in rat vascular smooth muscles." Biochem Biophys Res Commun. 296(2):463-469. PMID:12163042
  21. [ + ] Szamosfalvi B, et al. (2002) "Putative subunits of the rat mesangial KATP: a type 2B sulfonylurea receptor and an inwardly rectifying K+ channel." Kidney Int. 61(5):1739-1749. PMID:11967023
  22. [ + ] Dorschner H, et al. (1999) "Stoichiometry of sulfonylurea-induced ATP-sensitive potassium channel closure." Mol Pharmacol. 55(6):1060-1066. PMID:10347249
  23. [ + ] Inagaki N, et al. (1996) "A family of sulfonylurea receptors determines the pharmacological properties of ATP-sensitive K+ channels." Neuron. 16(5):1011-1017. PMID:8630239