GAB1 | GeneID:2549 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 2549 Official Symbol GAB1
Locus N/A Gene Type protein-coding
Synonyms
Full Name GRB2-associated binding protein 1
Description GRB2-associated binding protein 1
Chromosome 4q31.21
Also Known As
Summary The protein encoded by this gene is a member of the IRS1-like multisubstrate docking protein family. It is an important mediator of branching tubulogenesis and plays a central role in cellular growth response, transformation and apoptosis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 1542

ID Symbol Protein Species
GeneID:2549 GAB1 NP_997006.1 Homo sapiens
GeneID:14388 Gab1 NP_067331.2 Mus musculus
GeneID:361388 Gab1 XP_341668.3 Rattus norvegicus
GeneID:406666 zgc:56412 NP_998522.1 Danio rerio
GeneID:422456 GAB1 XP_001232602.1 Gallus gallus
GeneID:461516 GAB1 XP_517458.2 Pan troglodytes
GeneID:483808 GAB1 XP_540929.2 Canis lupus familiaris
GeneID:540085 GAB1 XP_591382.3 Bos taurus

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab12863 GAB1 (phospho Y627) antibody (ab12863); Rabbit polyclonal to GAB1 (phospho Y627)
2 abcam ab59993 GAB1 (phospho Y659) antibody (ab59993); Rabbit polyclonal to GAB1 (phospho Y659)
3 abcam ab59410 GAB1 (phospho Y659) antibody (ab59410); Rabbit polyclonal to GAB1 (phospho Y659)
4 abcam ab59362 GAB1 antibody (ab59362); Rabbit polyclonal to GAB1
5 abcam ab47771 GAB1 (phospho Y627) antibody (ab47771); Rabbit polyclonal to GAB1 (phospho Y627)
6 abcam ab47513 GAB1 antibody (ab47513); Rabbit polyclonal to GAB1
7 abcam ab32093 GAB1 antibody [Y423] (ab32093); Rabbit monoclonal [Y423] to GAB1
8 abcam ab32069 GAB1 (phospho Y627) antibody [E128] (ab32069); Rabbit monoclonal [E128] to GAB1 (phospho Y627)
9 abcam ab15298 GAB1 antibody, prediluted (ab15298); Rabbit polyclonal to GAB1, prediluted
10 abcam ab27439 GAB1 antibody (ab27439); Rabbit polyclonal to GAB1
11 abgent AP7832b GAB1 Antibody (Y627); Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
12 abgent AP7832c Gab1 Antibody (Y659); Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
13 abgent AP7832d GAB1 Antibody (Y259); Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
14 abgent AP3599a Phospho-GAB1-pY259 Antibody; Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
15 abgent AP3109b Phospho-Gab1-Y627 Antibody; Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
16 abgent AP3302b Phospho-Gab1-Y659 Antibody; Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
17 abgent AP3110a Gab1 Mutant Y659 Antibody; Purified Rabbit Polyclonal Antibody (Pab)
18 abgent AP3108a Phospho-Gab1-Y654 Antibody; Purified Rabbit Polyclonal Antibody (Pab)
19 abgent AP3109a Phospho-Gab1-Y627 Antibody; Purified Rabbit Polyclonal Antibody (Pab)
20 abgent AM3111a Gab1 antibody; Mouse Monoclonal Antibody (Mab)
21 abnova H00002549-M01 GAB1 monoclonal antibody (M01), clone 1B3; Mouse monoclonal antibody raised against a partial recombinant GAB1.
22 acris AP00600PU-N GAB1; antibody Ab
23 acris AP13009PU-N GAB1 pTyr259; antibody Ab
24 acris AP01829PU-N GAB1 pTyr659; antibody Ab
25 acris AP12617PU-N Gab1 Mutant pTyr659; antibody Ab
26 acris AP02777PU-N GAB1; antibody Ab
27 acris AM11053SU-N Gab1; antibody Ab
28 acris AP02777PU-S GAB1; antibody Ab
29 acris AP14661PU-N Gab1 Y659; antibody Ab
30 acris AP12754PU-N Gab1 pTyr659; antibody Ab
31 acris AP06525PU-N GAB1; antibody Ab
32 acris AP15569PU-S Gab-1; antibody Ab
33 acris AP02529PU-N GAB1 pTyr627; antibody Ab
34 acris AP02529PU-S GAB1 pTyr627; antibody Ab
35 acris AP12615PU-N Gab1 pTyr627; antibody Ab
36 acris AP14660PU-N GAB1 Y627; antibody Ab
37 acris AP15569PU-N Gab-1; antibody Ab
38 acris AP12616PU-N Gab1 pTyr627; antibody Ab
39 scbt GAB1 GAB1 Antibody / GAB1 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of GAB1 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of GAB1 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005829 Component cytosol
GO:0005515 Function protein binding
GO:0005070 Function SH3/SH2 adaptor activity
GO:0008283 Process cell proliferation
GO:0007173 Process epidermal growth factor receptor signaling pathway
GO:0008286 Process insulin receptor signaling pathway

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_002039  UCSC Browser NP_002030 A8K152   Q13480  
2 NM_207123  UCSC Browser NP_997006

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000262995 MI0000113 hsa-miR-106a AAAAGUGCUUACAGUGCAGGUAG
ENST00000262995 MI0000456 hsa-miR-140-3p UACCACAGGGUAGAACCACGG
ENST00000262995 MI0000071 hsa-miR-17 CAAAGUGCUUACAGUGCAGGUAG
ENST00000262995 MI0001518 hsa-miR-18b UAAGGUGCAUCUAGUGCAGUUAG
ENST00000262995 MI0000737 hsa-miR-200a UAACACUGUCUGGUAACGAUGU
ENST00000262995 MI0000342 hsa-miR-200b* CAUCUUACUGGGCAGCAUUGGA
ENST00000262995 MI0000293 hsa-miR-217 UACUGCAUCAGGAACUGAUUGGA
ENST00000262995 MI0000087 hsa-miR-29a UAGCACCAUCUGAAAUCGGUUA
ENST00000262995 MI0000105 hsa-miR-29b UAGCACCAUUUGAAAUCAGUGUU
ENST00000262995 MI0000107 hsa-miR-29b UAGCACCAUUUGAAAUCAGUGUU
ENST00000262995 MI0000735 hsa-miR-29c UAGCACCAUUUGAAAUCGGUUA
ENST00000262995 MI0000749 hsa-miR-30e UGUAAACAUCCUUGACUGGAAG
ENST00000262995 MI0000777 hsa-miR-369-3p AAUAAUACAUGGUUGAUCUUU
ENST00000262995 MI0000786 hsa-miR-378* CUCCUGACUCCAGGUCCUGUGU
ENST00000262995 MI0000787 hsa-miR-379* UAUGUAACAUGGUCCACUAACU
ENST00000262995 MI0002465 hsa-miR-410 AAUAUAACACAGAUGGCCUGU
ENST00000262995 MI0003675 hsa-miR-411* UAUGUAACACGGUCCACUAACC
ENST00000262995 MI0001652 hsa-miR-450a UUUUGCGAUGUGUUCCUAAUAU
ENST00000262995 MI0003187 hsa-miR-450a UUUUGCGAUGUGUUCCUAAUAU
ENST00000262995 MI0005531 hsa-miR-450b-5p UUUUGCAAUAUGUUCCUGAAUA
ENST00000262995 MI0003183 hsa-miR-499-3p AACAUCACAGCAAGUCUGUGCU
ENST00000262995 MI0003196 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENST00000262995 MI0005530 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENST00000262995 MI0005717 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENST00000262995 MI0003159 hsa-miR-518c CAAAGCGCUUCUCUUUAGAGUGU
ENST00000262995 MI0003178 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENST00000262995 MI0003182 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENST00000262995 MI0003151 hsa-miR-519b-3p AAAGUGCAUCCUUUUAGAGGUU
ENST00000262995 MI0003148 hsa-miR-519c-3p AAAGUGCAUCUUUUUAGAGGAU
ENST00000262995 MI0003610 hsa-miR-598 UACGUCAUCGUUGUCAUCGUCA
ENST00000262995 MI0003623 hsa-miR-610 UGAGCUAAAUGUGUGCUGGGA
ENST00000262995 MI0003632 hsa-miR-618 AAACUCUACUUGUCCUUCUGAGU
ENST00000262995 MI0003677 hsa-miR-655 AUAAUACAUGGUUAACCUCUUU
ENST00000262995 MI0000263 hsa-miR-7-1* CAACAAAUCACAGUCUGCCAUA
ENST00000262995 MI0000264 hsa-miR-7-2* CAACAAAUCCCAGUCUACCUAA
ENST00000262995 MI0005713 hsa-miR-921 CUAGUGAGGGACAGAACCAGGAUUC
ENST00000262995 MI0005763 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENST00000262995 MI0005764 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENST00000262995 MI0005765 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENST00000262995 MI0005766 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENST00000262995 MI0000101 hsa-miR-99a* CAAGCUCGCUUCUAUGGGUCUG
ENST00000262995 MI0000388 mmu-miR-290-3p AAAGUGCCGCCUAGUUUUAAGCCC
ENST00000262995 MI0003539 mmu-miR-291b-3p AAAGUGCAUCCAUUUUGUUUGU
ENST00000262995 MI0005512 mmu-miR-467c UAAGUGCGUGCAUGUAUAUGUG
ENST00000262995 MI0003523 mmu-miR-547 CUUGGUACAUCUUUGAGUGAG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

[ - ] Somatic Mutations in Cancer - Sanger's COSMIC

The mutation data was obtained from the Sanger Institute Catalogue Of Somatic Mutations In Cancer web site, http://www.sanger.ac.uk/cosmic Bamford et al (2004) The COSMIC (Catalogue of Somatic Mutations in Cancer) database and website. Br J Cancer, 91,355-358.
Mutation (top 10)Total Observations
c.1493G>T1
Primary Site / Histology (Top 10)Mutations (sites * observations)
lung / carcinoma1

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Calcitriol
  • Calcitriol results in increased expression of GAB1 mRNA
16002434
Carbon Tetrachloride
  • Carbon Tetrachloride affects the expression of GAB1 mRNA
17484886
Dietary Fats
  • Dietary Fats results in increased expression of GAB1 mRNA
18042831
Ethinyl Estradiol
  • Ethinyl Estradiol affects the expression of GAB1 mRNA
17555576
Hyaluronic Acid
  • Hyaluronic Acid results in increased phosphorylation of GAB1 protein
16864594
palm oil
  • palm oil results in increased expression of GAB1 mRNA
18042831
resveratrol
  • resveratrol inhibits the reaction [AGT protein results in increased phosphorylation of and results in increased localization of GAB1 protein]
  • resveratrol inhibits the reaction [EGF protein results in increased phosphorylation of and results in increased localization of GAB1 protein]
15849355
Tamoxifen
  • Tamoxifen affects the expression of GAB1 mRNA
17555576

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Breast Neoplasms inferred via Tamoxifen 16202921, 15565566, 11161223, 17242785, 16818667, 15668708, 17440819, 17893378, 17261762, 17049068, 16873071
Carcinoma, Hepatocellular inferred via Tamoxifen 16924424
Carcinoma, Transitional Cell inferred via Tamoxifen 17572228
Endometrial Neoplasms inferred via Tamoxifen 16202921, 17893378
Fatty Liver inferred via Tamoxifen 14986274
Female Urogenital Diseases inferred via Tamoxifen 16709447
Lipidoses inferred via Tamoxifen 15342952
Liver Cirrhosis, Experimental inferred via Tamoxifen 18564211
Liver Neoplasms inferred via Tamoxifen 16684651
Mammary Neoplasms, Experimental inferred via Tamoxifen 11731420, 14580682, 16827153
Melanoma inferred via Tamoxifen 12393984
Melanoma, Amelanotic inferred via Tamoxifen 15990972
Spermatocele inferred via Tamoxifen 16709447
Urinary Bladder Neoplasms inferred via Tamoxifen 16712894, 17572228
Adenoma inferred via resveratrol 15688382
Alzheimer Disease inferred via resveratrol 16183991, 16162502
Arthritis, Experimental inferred via resveratrol 17115116
Atherosclerosis inferred via resveratrol 16873680, 17967414
Brain Ischemia inferred via resveratrol 17600658
Breast Neoplasms inferred via resveratrol 17651959, 17534123, 16393696
Carcinoma, Hepatocellular inferred via resveratrol 16227395
Carcinoma, Lewis Lung inferred via resveratrol 16675471
Carcinoma, Squamous Cell inferred via resveratrol 16227395
Cardiovascular Diseases inferred via resveratrol 15458977
Colitis inferred via resveratrol 16474422
Colonic Neoplasms inferred via resveratrol 16338953
Colorectal Neoplasms inferred via resveratrol 16550006
Diabetes Mellitus, Experimental inferred via resveratrol 16873680
Diabetic Nephropathies inferred via resveratrol 16286809
Edema inferred via resveratrol 8985016
Encephalomyelitis, Autoimmune, Experimental inferred via resveratrol 17872969
Enterocolitis, Necrotizing inferred via resveratrol 17923197
Herpes Simplex inferred via resveratrol 16876885
Hypercholesterolemia inferred via resveratrol 17188708
Hyperlipidemias inferred via resveratrol 16873680
Hypertrophy, Left Ventricular inferred via resveratrol 17488730
Infarction, Middle Cerebral Artery inferred via resveratrol 17600658
Inflammation inferred via resveratrol 16366677
Influenza, Human inferred via resveratrol 16624496
Kidney Failure, Acute inferred via resveratrol 16538975
Leukemia, Promyelocytic, Acute inferred via resveratrol 16087638
Lymphoma, B-Cell inferred via resveratrol 17088997
Lymphoma, Non-Hodgkin inferred via resveratrol 14749477
Mammary Neoplasms, Animal inferred via resveratrol 15688416
Mammary Neoplasms, Experimental inferred via resveratrol 8985016, 11606380
Melanoma inferred via resveratrol 17992120
Metabolic Diseases inferred via resveratrol 17112576
Multiple Myeloma inferred via resveratrol 14749477, 17935668, 17049120, 16267019, 16490592, 17164350
Muscular Atrophy, Spinal inferred via resveratrol 17962980
Myocardial Infarction inferred via resveratrol 17188708, 16525036, 17125593, 16456233, 16317513, 17015251
Myocardial Ischemia inferred via resveratrol 17125593, 17015251
Myocarditis inferred via resveratrol 17322642
Neoplasms, Experimental inferred via resveratrol 8985016
Neurodegenerative Diseases inferred via resveratrol 17652729
Neurogenic Inflammation inferred via resveratrol 17929310
Osteoporosis, Postmenopausal inferred via resveratrol 17513867
Prenatal Exposure Delayed Effects inferred via resveratrol 16679765
Prostatic Neoplasms inferred via resveratrol 17675339, 17718901, 17636462, 17804756, 16731767, 15767336
Renal Insufficiency, Chronic inferred via resveratrol 16325855
Reperfusion Injury inferred via resveratrol 17058453, 17520802, 15827377, 16317513, 16314181
Skin Neoplasms inferred via resveratrol 15837718, 8985016
STROKE, ISCHEMIC inferred via resveratrol 16321402
Tongue Neoplasms inferred via resveratrol 16227395
Uterine Cervical Neoplasms inferred via resveratrol 17473185
Uterine Neoplasms inferred via resveratrol 17044934
Ventricular Dysfunction, Left inferred via resveratrol 17488730
Prostatic Neoplasms inferred via Hyaluronic Acid 16864594
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 16919318, 17681005, 16105132, 11677210, 15861022, 17333356
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587
Arteriosclerosis inferred via Dietary Fats 15238619
Dyslipidemias inferred via Dietary Fats 18367378
Insulin Resistance inferred via Dietary Fats 18457598
Obesity inferred via Dietary Fats 18457598, 17217161
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 16011737, 16097048, 15673190, 16050911, 10355542, 16124888, 16227642, 15700767
Fatty Liver inferred via Carbon Tetrachloride 16045604, 15959796, 17595544, 12631006, 61145, 12795759, 16239168
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 15998439, 15968718, 15027814, 16227642, 16177239, 11566570
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 16943688, 16221502, 16239168, 17334410
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 17525996, 17557913, 18156304, 16638106, 13678700, 15818738, 17631135, 16097048, 15673190, 12649538, 17721639, 18277467, 18205269, 18279442, 16027843, 15996030, 16033810, 17565644, 17869086, 17708605, 12667390, 14748882, 14716496, 15730626, 12632514, 15052691, 12632512, 17766677, 18418968, 12666154, 15057751, 12586293, 18054572, 10355542, 16011737, 18251166, 17823541, 17944888, 18395914, 12445418, 15959796, 12898905, 18317297, 17761835, 14620537, 18472332, 14716833, 16136751, 12741479, 14724832, 18472094, 15931870, 17698563, 15893842, 12958196, 17640975, 18412020, 18376398, 12389079, 18187930, 18210741, 16015684, 17714472, 14512876, 12609069, 18166357, 17922224, 18420326, 15876570, 12445421, 17481882, 17900296, 15123356, 18339082, 18429990, 12546737, 18006644, 18481824, 18395095, 17976157, 17805973, 16248980, 16116963, 15925388
Liver Diseases inferred via Carbon Tetrachloride 16246199, 16964402, 17285989, 15830285, 15720792
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823
Breast Neoplasms inferred via Calcitriol 11237771
Carcinoma, Squamous Cell inferred via Calcitriol 11237771
Encephalomyelitis, Autoimmune, Experimental inferred via Calcitriol 15138306
Prostatic Hyperplasia inferred via Calcitriol 15572423
Prostatic Neoplasms inferred via Calcitriol 12479363, 16289102, 16644109

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
C1QBP GAB1 / C1QBP Affinity Capture-Western Braun L (2000)
CRKL GAB1 / CRKL Invitro Sakkab D (2000)
CRKL GAB1 / CRKL Invivo Sakkab D (2000)
EGFR EGFR / GAB1 Affinity Capture-Western Kameda H (2001)
GRAP2 GRAP2 / GAB1 Two-hybrid Qiu M (1998)
GRB2 GAB1 / GRB2 Affinity Capture-Western Holgado-Madruga M (1996)
GRB2 GRB2 / GAB1 Affinity Capture-Western Lewitzky M (2001)
GRB2 GRB2 / GAB1 Affinity Capture-Western Oneyama C (2002)
GRB2 GAB1 / GRB2 Far Western Holgado-Madruga M (1996)
GRB2 GAB1 / GRB2 Reconstituted Complex Holgado-Madruga M (1996)
GRB2 GRB2 / GAB1 Reconstituted Complex Lewitzky M (2001)
GRB2 GAB1 / GRB2 Two-hybrid Lewitzky M (2001)
INSR GAB1 / INSR Two-hybrid Rocchi S (1998)
MAP3K3 MAP3K3 / GAB1 Affinity Capture-Western Che W (2002)
MAP3K3 MAP3K3 / GAB1 Reconstituted Complex Che W (2002)
PIK3R1 GAB1 / PIK3R1 Affinity Capture-Western Holgado-Madruga M (1996)
PIK3R1 GAB1 / PIK3R1 Far Western Holgado-Madruga M (1996)
PIK3R1 PIK3R1 / GAB1 Reconstituted Complex Bertagnolo V (1998)
PLCG1 GAB1 / PLCG1 Affinity Capture-Western Holgado-Madruga M (1996)
PLCG1 GAB1 / PLCG1 Affinity Capture-Western Ueno E (2001)
PLCG1 PLCG1 / GAB1 Affinity Capture-Western Ueno E (2001)
PLCG1 GAB1 / PLCG1 Far Western Holgado-Madruga M (1996)
PTPN11 GAB1 / PTPN11 Affinity Capture-Western Saito Y (2002)
RICS RICS / GAB1 Affinity Capture-Western Zhao C (2003)
ROCK1 ROCK1 / GAB1 Co-crystal Structure Bourguignon LY (2003)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Barr AJ, et al. (2009) "Large-scale structural analysis of the classical human protein tyrosine phosphatome." Cell. 136(2):352-363. PMID:19167335
  2. [ + ] Caron C, et al. (2009) "Non-redundant roles of the Gab1 and Gab2 scaffolding adapters in VEGF-mediated signalling, migration, and survival of endothelial cells." Cell Signal. 21(6):943-953. PMID:19233262
  3. [ + ] Oka M, et al. (2008) "Protein kinase C-betaII represses hepatocyte growth factor-induced invasion by preventing the association of adapter protein Gab1 and phosphatidylinositol 3-kinase in melanoma cells." J Invest Dermatol. 128(1):188-195. PMID:17625596
  4. [ + ] Kondo A, et al. (2008) "Coupling of Grb2 to Gab1 mediates hepatocyte growth factor-induced high intensity ERK signal required for inhibition of HepG2 hepatoma cell proliferation." J Biol Chem. 283(3):1428-1436. PMID:18003605
  5. [ + ] Seiden-Long I, et al. (2008) "Gab1 but not Grb2 mediates tumor progression in Met overexpressing colorectal cancer cells." Carcinogenesis. 29(3):647-655. PMID:18192688
  6. [ + ] Koyama T, et al. (2008) "Interaction of scaffolding adaptor protein Gab1 with tyrosine phosphatase SHP2 negatively regulates IGF-I-dependent myogenic differentiation via the ERK1/2 signaling pathway." J Biol Chem. 283(35):24234-24244. PMID:18577518
  7. [ + ] Goto Y, et al. (2007) "Grb2-associated binder 1 polymorphism was associated with the risk of Helicobactor pylori infection and gastric atrophy." Int J Med Sci. 4(1):1-6. PMID:17211494
  8. [ + ] Laramee M, et al. (2007) "The scaffolding adapter Gab1 mediates vascular endothelial growth factor signaling and is required for endothelial cell migration and capillary formation." J Biol Chem. 282(11):7758-7769. PMID:17178724
  9. [ + ] Krejci P, et al. (2007) "Bisindolylmaleimide I suppresses fibroblast growth factor-mediated activation of Erk MAP kinase in chondrocytes by preventing Shp2 association with the Frs2 and Gab1 adaptor proteins." J Biol Chem. 282(5):2929-2936. PMID:17145761
  10. [ + ] Watanabe T, et al. (2006) "Adaptor molecule Crk is required for sustained phosphorylation of Grb2-associated binder 1 and hepatocyte growth factor-induced cell motility of human synovial sarcoma cell lines." Mol Cancer Res. 4(7):499-510. PMID:16849525
  11. [ + ] Dance M, et al. (2006) "The adaptor protein Gab1 couples the stimulation of vascular endothelial growth factor receptor-2 to the activation of phosphoinositide 3-kinase." J Biol Chem. 281(32):23285-23295. PMID:16787925
  12. [ + ] Kiyatkin A, et al. (2006) "Scaffolding protein Grb2-associated binder 1 sustains epidermal growth factor-induced mitogenic and survival signaling by multiple positive feedback loops." J Biol Chem. 281(29):19925-19938. PMID:16687399
  13. [ + ] Kimura K, et al. (2006) "Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes." Genome Res. 16(1):55-65. PMID:16344560
  14. [ + ] Montagner A, et al. (2005) "A novel role for Gab1 and SHP2 in epidermal growth factor-induced Ras activation." J Biol Chem. 280(7):5350-5360. PMID:15574420
  15. [ + ] Jin ZG, et al. (2005) "Flow shear stress stimulates Gab1 tyrosine phosphorylation to mediate protein kinase B and endothelial nitric-oxide synthase activation in endothelial cells." J Biol Chem. 280(13):12305-12309. PMID:15665327
  16. [ + ] Meng S, et al. (2005) "Participation of both Gab1 and Gab2 in the activation of the ERK/MAPK pathway by epidermal growth factor." Biochem J. 391(Pt 1):143-151. PMID:15952937
  17. [ + ] De Falco V, et al. (2005) "RAI(ShcC/N-Shc)-dependent recruitment of GAB 1 to RET oncoproteins potentiates PI 3-K signalling in thyroid tumors." Oncogene. 24(41):6303-6313. PMID:15940252
  18. [ + ] Hillier LW, et al. (2005) "Generation and annotation of the DNA sequences of human chromosomes 2 and 4." Nature. 434(7034):724-731. PMID:15815621
  19. [ + ] Kapoor GS, et al. (2004) "Distinct domains in the SHP-2 phosphatase differentially regulate epidermal growth factor receptor/NF-kappaB activation through Gab1 in glioblastoma cells." Mol Cell Biol. 24(2):823-836. PMID:14701753
  20. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  21. [ + ] Lehr S, et al. (2004) "Identification of major ERK-related phosphorylation sites in Gab1." Biochemistry. 43(38):12133-12140. PMID:15379552
  22. [ + ] Maeda K, et al. (2004) "Biochemical and biological responses induced by coupling of Gab1 to phosphatidylinositol 3-kinase in RET-expressing cells." Biochem Biophys Res Commun. 323(1):345-354. PMID:15351743
  23. [ + ] Podar K, et al. (2004) "Critical role for hematopoietic cell kinase (Hck)-mediated phosphorylation of Gab1 and Gab2 docking proteins in interleukin 6-induced proliferation and survival of multiple myeloma cells." J Biol Chem. 279(20):21658-21665. PMID:15010462
  24. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  25. [ + ] Ren Y, et al. (2004) "Roles of Gab1 and SHP2 in paxillin tyrosine dephosphorylation and Src activation in response to epidermal growth factor." J Biol Chem. 279(9):8497-8505. PMID:14665621
  26. [ + ] Zhao C, et al. (2003) "GC-GAP, a Rho family GTPase-activating protein that interacts with signaling adapters Gab1 and Gab2." J Biol Chem. 278(36):34641-34653. PMID:12819203
  27. [ + ] Agazie YM, et al. (2003) "Molecular mechanism for a role of SHP2 in epidermal growth factor receptor signaling." Mol Cell Biol. 23(21):7875-7886. PMID:14560030
  28. [ + ] Holgado-Madruga M, et al. (2003) "Gab1 is an integrator of cell death versus cell survival signals in oxidative stress." Mol Cell Biol. 23(13):4471-4484. PMID:12808090
  29. [ + ] Lock LS, et al. (2003) "Grb2-independent recruitment of Gab1 requires the C-terminal lobe and structural integrity of the Met receptor kinase domain." J Biol Chem. 278(32):30083-30090. PMID:12766170
  30. [ + ] Bourguignon LY, et al. (2003) "Hyaluronan-mediated CD44 interaction with RhoGEF and Rho kinase promotes Grb2-associated binder-1 phosphorylation and phosphatidylinositol 3-kinase signaling leading to cytokine (macrophage-colony stimulating factor) production and breast tumor progression." J Biol Chem. 278(32):29420-29434. PMID:12748184
  31. [ + ] Agazie YM, et al. (2003) "Development of an efficient "substrate-trapping" mutant of Src homology phosphotyrosine phosphatase 2 and identification of the epidermal growth factor receptor, Gab1, and three other proteins as target substrates." J Biol Chem. 278(16):13952-13958. PMID:12582165
  32. [ + ] Salomon AR, et al. (2003) "Profiling of tyrosine phosphorylation pathways in human cells using mass spectrometry." Proc Natl Acad Sci U S A. 100(2):443-448. PMID:12522270
  33. [ + ] Nakaoka Y, et al. (2003) "Activation of gp130 transduces hypertrophic signal through interaction of scaffolding/docking protein Gab1 with tyrosine phosphatase SHP2 in cardiomyocytes." Circ Res. 93(3):221-229. PMID:12855672
  34. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  35. [ + ] Petrelli A, et al. (2002) "The endophilin-CIN85-Cbl complex mediates ligand-dependent downregulation of c-Met." Nature. 416(6877):187-190. PMID:11894096
  36. [ + ] Yu CF, et al. (2002) "ERK negatively regulates the epidermal growth factor-mediated interaction of Gab1 and the phosphatidylinositol 3-kinase." J Biol Chem. 277(22):19382-19388. PMID:11896055
  37. [ + ] Saito Y, et al. (2002) "Protein kinase C-alpha and protein kinase C-epsilon are required for Grb2-associated binder-1 tyrosine phosphorylation in response to platelet-derived growth factor." J Biol Chem. 277(26):23216-23222. PMID:11940581
  38. [ + ] Oneyama C, et al. (2002) "UCS15A, a novel small molecule, SH3 domain-mediated protein-protein interaction blocking drug." Oncogene. 21(13):2037-2050. PMID:11960376
  39. [ + ] Che W, et al. (2002) "Insulin-like growth factor-1 enhances inflammatory responses in endothelial cells: role of Gab1 and MEKK3 in TNF-alpha-induced c-Jun and NF-kappaB activation and adhesion molecule expression." Circ Res. 90(11):1222-1230. PMID:12065326
  40. [ + ] Lamorte L, et al. (2002) "Crk synergizes with epidermal growth factor for epithelial invasion and morphogenesis and is required for the met morphogenic program." J Biol Chem. 277(40):37904-37911. PMID:12138161
  41. [ + ] Cai T, et al. (2002) "Gab1 and SHP-2 promote Ras/MAPK regulation of epidermal growth and differentiation." J Cell Biol. 159(1):103-112. PMID:12370245
  42. [ + ] Brdicka T, et al. (2002) "Non-T cell activation linker (NTAL): a transmembrane adaptor protein involved in immunoreceptor signaling." J Exp Med. 196(12):1617-1626. PMID:12486104
  43. [ + ] Ong SH, et al. (2001) "ShcA and Grb2 mediate polyoma middle T antigen-induced endothelial transformation and Gab1 tyrosine phosphorylation." EMBO J. 20(22):6327-6336. PMID:11707404
  44. [ + ] Yamada K, et al. (2001) "Comparative FISH mapping of Gab1 and Gab2 genes in human, mouse and rat." Cytogenet Cell Genet. 94(1-2):39-42. PMID:11701952
  45. [ + ] Onishi-Haraikawa Y, et al. (2001) "Unique phosphorylation mechanism of Gab1 using PI 3-kinase as an adaptor protein." Biochem Biophys Res Commun. 288(2):476-482. PMID:11606067
  46. [ + ] Ueno E, et al. (2001) "Potential role of Gab1 and phospholipase C-gamma in osmotic shock-induced glucose uptake in 3T3-L1 adipocytes." Horm Metab Res. 33(7):402-406. PMID:11507676
  47. [ + ] Kameda H, et al. (2001) "Identification of epidermal growth factor receptor- Grb2-associated binder-1-SHP-2 complex formation and its functional loss during neoplastic cell progression." Cell Growth Differ. 12(6):307-318. PMID:11432805
  48. [ + ] Kurokawa K, et al. (2001) "Identification of SNT/FRS2 docking site on RET receptor tyrosine kinase and its role for signal transduction." Oncogene. 20(16):1929-1938. PMID:11360177
  49. [ + ] Cunnick JM, et al. (2001) "Phosphotyrosines 627 and 659 of Gab1 constitute a bisphosphoryl tyrosine-based activation motif (BTAM) conferring binding and activation of SHP2." J Biol Chem. 276(26):24380-24387. PMID:11323411
  50. [ + ] Lewitzky M, et al. (2001) "The C-terminal SH3 domain of the adapter protein Grb2 binds with high affinity to sequences in Gab1 and SLP-76 which lack the SH3-typical P-x-x-P core motif." Oncogene. 20(9):1052-1062. PMID:11314042