FYN | GeneID:2534 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 2534 Official Symbol FYN
Locus RP1-66H14.1 Gene Type protein-coding
Synonyms MGC45350; SLK; SYN
Full Name FYN oncogene related to SRC, FGR, YES
Description FYN oncogene related to SRC, FGR, YES
Chromosome 6q21
Also Known As OKT3-induced calcium influx regulator; OTTHUMP00000017914; OTTHUMP00000017915; OTTHUMP00000017917; c-syn protooncogene; protein-tyrosine kinase fyn; proto-oncogene tyrosine-protein kinase fyn; src-like kinase; src/yes-related novel; tyrosine kinase p59fyn(T)
Summary This gene is a member of the protein-tyrosine kinase oncogene family. It encodes a membrane-associated tyrosine kinase that has been implicated in the control of cell growth. The protein associates with the p85 subunit of phosphatidylinositol 3-kinase and interacts with the fyn-binding protein. Alternatively spliced transcript variants encoding distinct isoforms exist. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 48068

ID Symbol Protein Species
GeneID:2534 FYN NP_002028.1 Homo sapiens
GeneID:14360 Fyn NP_032080.1 Mus musculus
GeneID:25150 Fyn NP_036887.1 Rattus norvegicus
GeneID:171722 src-1 NP_490866.4 Caenorhabditis elegans
GeneID:396294 FYN NP_990680.1 Gallus gallus
GeneID:462944 FYN XP_001158524.1 Pan troglodytes
GeneID:475032 FYN XP_868515.1 Canis lupus familiaris
GeneID:527263 FYN XP_001251203.1 Bos taurus
GeneID:574422 fynb NP_001025140.1 Danio rerio

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab13955 Fyn antibody (ab13955); Rabbit polyclonal to Fyn
2 abcam ab53690 Fyn (phospho Y530) antibody (ab53690); Rabbit polyclonal to Fyn (phospho Y530)
3 abcam ab32022 Fyn antibody [Y303] (ab32022); Rabbit monoclonal [Y303] to Fyn
4 abcam ab3116 Fyn antibody [1S] (ab3116); Mouse monoclonal [1S] to Fyn
5 abcam ab802 Fyn antibody (ab802); Goat polyclonal to Fyn
6 abcam ab1881 Fyn antibody [FYN-01] (ab1881); Mouse monoclonal [FYN-01] to Fyn
7 abcam ab71676 Fyn antibody (ab71676); Rabbit polyclonal to Fyn
8 abcam ab54243 Fyn antibody [SPM247], prediluted (ab54243); Mouse monoclonal [SPM247] to Fyn, prediluted
9 abgent AP7709a FYN Antibody (N-term); Purified Rabbit Polyclonal Antibody (Pab)
10 abnova H00002534-M03 FYN monoclonal antibody (M03), clone 1A3; Mouse monoclonal antibody raised against a partial recombinant FYN.
11 abnova H00002534-M04 FYN monoclonal antibody (M04), clone 2G2; Mouse monoclonal antibody raised against a partial recombinant FYN.
12 abnova H00002534-M01 FYN monoclonal antibody (M01), clone 3G11-F9; Mouse monoclonal antibody raised against a full length recombinant FYN.
13 abnova H00002534-M02 FYN monoclonal antibody (M02), clone 3A8; Mouse monoclonal antibody raised against a partial recombinant FYN.
14 acris AP14467PU-N FYN (N-term); antibody Ab
15 acris AP08165PU-N FYN (aa 23-216); antibody Ab
16 acris AM05300PU-N FYN; antibody
17 acris AM06024PU-N FYN; antibody Ab
18 acris AP15908PU-N FYN (N-term); antibody Ab
19 acris SM3108P FYN; antibody Ab
20 acris AP15567PU-N FYN (aa 23-216); antibody Ab
21 acris SP1361P FYN; antibody Ab
22 acris SP1185 FYN; antibody Ab
23 acris AP15567PU-S FYN (aa 23-216); antibody Ab
24 acris AP01588PU-N FYN pTyr530; antibody Ab
25 acris AP18026PU-N FYN N-term; antibody Ab
26 scbt FYN FYN Antibody / FYN Antibodies;
27 sigma P2992 Monoclonal Anti-p59fyn antibody produced in mouse ;

Exon, Intron and UTRs

Exon, Intron and UTRs of FYN Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of FYN Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005829 Component cytosol
GO:0005768 Component endosome
GO:0005886 Component plasma membrane
GO:0005524 Function ATP binding
GO:0001948 Function glycoprotein binding
GO:0042802 Function identical protein binding
GO:0030145 Function manganese ion binding
GO:0046872 Function metal ion binding
GO:0004715 Function non-membrane spanning protein tyrosine kinase activity
GO:0000166 Function nucleotide binding
GO:0016740 Function transferase activity
GO:0006816 Process calcium ion transport
GO:0007631 Process feeding behavior
GO:0044419 Process interspecies interaction between organisms
GO:0007612 Process learning
GO:0007275 Process multicellular organismal development
GO:0006468 Process protein amino acid phosphorylation
GO:0007243 Process protein kinase cascade
GO:0050852 Process T cell receptor signaling pathway

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_002037  UCSC Browser NP_002028 P06241   B5BU57  
2 NM_153047  UCSC Browser NP_694592
3 NM_153048  UCSC Browser NP_694593

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000356013 MI0000060 hsa-let-7a* CUAUACAAUCUACUGUCUUUC
ENST00000356013 MI0000062 hsa-let-7a* CUAUACAAUCUACUGUCUUUC
ENST00000356013 MI0000064 hsa-let-7c* UAGAGUUACACCCUGGGAGUUA
ENST00000356013 MI0000067 hsa-let-7f-1* CUAUACAAUCUAUUGCCUUCCC
ENST00000356013 MI0000301 hsa-miR-224 CAAGUCACUAGUGGUUCCGUU
ENST00000356013 MI0000803 hsa-miR-330-5p UCUCUGGGCCUGUGUCUUAGGC
ENST00000356013 MI0000778 hsa-miR-370 GCCUGCUGGGGUGGAACCUGGU
ENST00000356013 MI0000788 hsa-miR-380 UAUGUAAUAUGGUCCACAUCUU
ENST00000356013 MI0002465 hsa-miR-410 AAUAUAACACAGAUGGCCUGU
ENST00000356013 MI0001733 hsa-miR-452 AACUGUUUGCAGAGGAAACUGA
ENST00000356013 MI0002470 hsa-miR-486-3p CGGGGCAGCUCAGUACAGGAU
ENST00000356013 MI0003124 hsa-miR-489 GUGACAUCACAUAUACGGCAGC
ENST00000356013 MI0003170 hsa-miR-518a-3p GAAAGCGCUUCCCUUUGCUGGA
ENST00000356013 MI0003173 hsa-miR-518a-3p GAAAGCGCUUCCCUUUGCUGGA
ENST00000356013 MI0003590 hsa-miR-583 CAAAGAGGAAGGUCCCAUUAC
ENST00000356013 MI0003617 hsa-miR-604 AGGCUGCGGAAUUCAGGAC
ENST00000356013 MI0003638 hsa-miR-624 CACAAGGUAUUGGUAUUACCU
ENST00000356013 MI0003661 hsa-miR-646 AAGCAGCUGCCUCUGAGGC
ENST00000356013 MI0005540 hsa-miR-889 UUAAUAUCGGACAACCAUUGU
ENST00000356013 MI0005761 hsa-miR-939 UGGGGAGCUGAGGCUCUGGGGGUG
ENST00000356013 MI0000098 hsa-miR-96 UUUGGCACUAGCACAUUUUUGCU
ENST00000356013 MI0004688 mmu-miR-704 AGACAUGUGCUCUGCUCCUAG
ENST00000356013 MI0005205 mmu-miR-741 UGAGAGAUGCCAUUCUAUGUAGA
ENST00000356013 MI0000644 rno-miR-352 AGAGUAGUAGGUUGCAUAGUA
ENST00000368667 MI0000060 hsa-let-7a* CUAUACAAUCUACUGUCUUUC
ENST00000368667 MI0000062 hsa-let-7a* CUAUACAAUCUACUGUCUUUC
ENST00000368667 MI0000064 hsa-let-7c* UAGAGUUACACCCUGGGAGUUA
ENST00000368667 MI0000067 hsa-let-7f-1* CUAUACAAUCUAUUGCCUUCCC
ENST00000368667 MI0000253 hsa-miR-148a UCAGUGCACUACAGAACUUUGU
ENST00000368667 MI0000811 hsa-miR-148b UCAGUGCAUCACAGAACUUUGU
ENST00000368667 MI0000301 hsa-miR-224 CAAGUCACUAGUGGUUCCGUU
ENST00000368667 MI0000803 hsa-miR-330-5p UCUCUGGGCCUGUGUCUUAGGC
ENST00000368667 MI0000778 hsa-miR-370 GCCUGCUGGGGUGGAACCUGGU
ENST00000368667 MI0000784 hsa-miR-376a AUCAUAGAGGAAAAUCCACGU
ENST00000368667 MI0003529 hsa-miR-376a AUCAUAGAGGAAAAUCCACGU
ENST00000368667 MI0000788 hsa-miR-380 UAUGUAAUAUGGUCCACAUCUU
ENST00000368667 MI0002465 hsa-miR-410 AAUAUAACACAGAUGGCCUGU
ENST00000368667 MI0003675 hsa-miR-411* UAUGUAACACGGUCCACUAACC
ENST00000368667 MI0001733 hsa-miR-452 AACUGUUUGCAGAGGAAACUGA
ENST00000368667 MI0002470 hsa-miR-486-3p CGGGGCAGCUCAGUACAGGAU
ENST00000368667 MI0003124 hsa-miR-489 GUGACAUCACAUAUACGGCAGC
ENST00000368667 MI0003170 hsa-miR-518a-3p GAAAGCGCUUCCCUUUGCUGGA
ENST00000368667 MI0003173 hsa-miR-518a-3p GAAAGCGCUUCCCUUUGCUGGA
ENST00000368667 MI0003154 hsa-miR-518f GAAAGCGCUUCUCUUUAGAGG
ENST00000368667 MI0003576 hsa-miR-569 AGUUAAUGAAUCCUGGAAAGU
ENST00000368667 MI0003590 hsa-miR-583 CAAAGAGGAAGGUCCCAUUAC
ENST00000368667 MI0003594 hsa-miR-586 UAUGCAUUGUAUUUUUAGGUCC
ENST00000368667 MI0003617 hsa-miR-604 AGGCUGCGGAAUUCAGGAC
ENST00000368667 MI0003634 hsa-miR-620 AUGGAGAUAGAUAUAGAAAU
ENST00000368667 MI0003638 hsa-miR-624 CACAAGGUAUUGGUAUUACCU
ENST00000368667 MI0003654 hsa-miR-639 AUCGCUGCGGUUGCGAGCGCUGU
ENST00000368667 MI0003661 hsa-miR-646 AAGCAGCUGCCUCUGAGGC
ENST00000368667 MI0005540 hsa-miR-889 UUAAUAUCGGACAACCAUUGU
ENST00000368667 MI0005761 hsa-miR-939 UGGGGAGCUGAGGCUCUGGGGGUG
ENST00000368667 MI0005769 hsa-miR-944 AAAUUAUUGUACAUCGGAUGAG
ENST00000368667 MI0000098 hsa-miR-96 UUUGGCACUAGCACAUUUUUGCU
ENST00000368667 MI0004688 mmu-miR-704 AGACAUGUGCUCUGCUCCUAG
ENST00000368667 MI0005205 mmu-miR-741 UGAGAGAUGCCAUUCUAUGUAGA
ENST00000368667 MI0000644 rno-miR-352 AGAGUAGUAGGUUGCAUAGUA
ENST00000368678 MI0000064 hsa-let-7c* UAGAGUUACACCCUGGGAGUUA
ENST00000368678 MI0000067 hsa-let-7f-1* CUAUACAAUCUAUUGCCUUCCC
ENST00000368678 MI0000253 hsa-miR-148a UCAGUGCACUACAGAACUUUGU
ENST00000368678 MI0000811 hsa-miR-148b UCAGUGCAUCACAGAACUUUGU
ENST00000368678 MI0000273 hsa-miR-183 UAUGGCACUGGUAGAAUUCACU
ENST00000368678 MI0000301 hsa-miR-224 CAAGUCACUAGUGGUUCCGUU
ENST00000368678 MI0000808 hsa-miR-326 CCUCUGGGCCCUUCCUCCAG
ENST00000368678 MI0000803 hsa-miR-330-5p UCUCUGGGCCUGUGUCUUAGGC
ENST00000368678 MI0000777 hsa-miR-369-3p AAUAAUACAUGGUUGAUCUUU
ENST00000368678 MI0000778 hsa-miR-370 GCCUGCUGGGGUGGAACCUGGU
ENST00000368678 MI0000784 hsa-miR-376a AUCAUAGAGGAAAAUCCACGU
ENST00000368678 MI0003529 hsa-miR-376a AUCAUAGAGGAAAAUCCACGU
ENST00000368678 MI0002466 hsa-miR-376b AUCAUAGAGGAAAAUCCAUGUU
ENST00000368678 MI0000788 hsa-miR-380 UAUGUAAUAUGGUCCACAUCUU
ENST00000368678 MI0002465 hsa-miR-410 AAUAUAACACAGAUGGCCUGU
ENST00000368678 MI0001733 hsa-miR-452 AACUGUUUGCAGAGGAAACUGA
ENST00000368678 MI0002470 hsa-miR-486-3p CGGGGCAGCUCAGUACAGGAU
ENST00000368678 MI0003124 hsa-miR-489 GUGACAUCACAUAUACGGCAGC
ENST00000368678 MI0003170 hsa-miR-518a-3p GAAAGCGCUUCCCUUUGCUGGA
ENST00000368678 MI0003173 hsa-miR-518a-3p GAAAGCGCUUCCCUUUGCUGGA
ENST00000368678 MI0003156 hsa-miR-518b CAAAGCGCUCCCCUUUAGAGGU
ENST00000368678 MI0003171 hsa-miR-518d-3p CAAAGCGCUUCCCUUUGGAGC
ENST00000368678 MI0003169 hsa-miR-518e AAAGCGCUUCCCUUCAGAGUG
ENST00000368678 MI0003154 hsa-miR-518f GAAAGCGCUUCUCUUUAGAGG
ENST00000368678 MI0003146 hsa-miR-520f AAGUGCUUCCUUUUAGAGGGUU
ENST00000368678 MI0003563 hsa-miR-557 GUUUGCACGGGUGGGCCUUGUCU
ENST00000368678 MI0003576 hsa-miR-569 AGUUAAUGAAUCCUGGAAAGU
ENST00000368678 MI0003590 hsa-miR-583 CAAAGAGGAAGGUCCCAUUAC
ENST00000368678 MI0003594 hsa-miR-586 UAUGCAUUGUAUUUUUAGGUCC
ENST00000368678 MI0003617 hsa-miR-604 AGGCUGCGGAAUUCAGGAC
ENST00000368678 MI0003629 hsa-miR-616 AGUCAUUGGAGGGUUUGAGCAG
ENST00000368678 MI0003634 hsa-miR-620 AUGGAGAUAGAUAUAGAAAU
ENST00000368678 MI0003638 hsa-miR-624 CACAAGGUAUUGGUAUUACCU
ENST00000368678 MI0003645 hsa-miR-631 AGACCUGGCCCAGACCUCAGC
ENST00000368678 MI0003654 hsa-miR-639 AUCGCUGCGGUUGCGAGCGCUGU
ENST00000368678 MI0003661 hsa-miR-646 AAGCAGCUGCCUCUGAGGC
ENST00000368678 MI0003906 hsa-miR-802 CAGUAACAAAGAUUCAUCCUUGU
ENST00000368678 MI0005562 hsa-miR-887 GUGAACGGGCGCCAUCCCGAGG
ENST00000368678 MI0005540 hsa-miR-889 UUAAUAUCGGACAACCAUUGU
ENST00000368678 MI0005713 hsa-miR-921 CUAGUGAGGGACAGAACCAGGAUUC
ENST00000368678 MI0005761 hsa-miR-939 UGGGGAGCUGAGGCUCUGGGGGUG
ENST00000368678 MI0005769 hsa-miR-944 AAAUUAUUGUACAUCGGAUGAG
ENST00000368678 MI0000098 hsa-miR-96 UUUGGCACUAGCACAUUUUUGCU
ENST00000368678 MI0004650 mmu-miR-686 AUUGCUUCCCAGACGGUGAAGA
ENST00000368678 MI0004688 mmu-miR-704 AGACAUGUGCUCUGCUCCUAG
ENST00000368678 MI0004698 mmu-miR-713 UGCACUGAAGGCACACAGC
ENST00000368678 MI0005205 mmu-miR-741 UGAGAGAUGCCAUUCUAUGUAGA
ENST00000368678 MI0004310 mmu-miR-764-3p AGGAGGCCAUAGUGGCAACUGU
ENST00000368678 MI0005548 mmu-miR-878-3p GCAUGACACCACACUGGGUAGA
ENST00000368678 MI0000644 rno-miR-352 AGAGUAGUAGGUUGCAUAGUA
ENST00000368682 MI0000437 hsa-miR-1 UGGAAUGUAAAGAAGUAUGUAU
ENST00000368682 MI0000651 hsa-miR-1 UGGAAUGUAAAGAAGUAUGUAU
ENST00000368682 MI0000457 hsa-miR-141* CAUCUUCCAGUACAGUGUUGGA
ENST00000368682 MI0000490 hsa-miR-206 UGGAAUGUAAGGAAGUGUGUGG
ENST00000368682 MI0003183 hsa-miR-499-5p UUAAGACUUGCAGUGAUGUUU
ENST00000368682 MI0003165 hsa-miR-517b UCGUGCAUCCCUUUAGAGUGUU
ENST00000368682 MI0003617 hsa-miR-604 AGGCUGCGGAAUUCAGGAC
ENST00000368682 MI0004659 mmu-miR-691 AUUCCUGAAGAGAGGCAGAAAA
ENST00000368682 MI0004708 mmu-miR-721 CAGUGCAAUUAAAAGGGGGAA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

[ - ] Somatic Mutations in Cancer - Sanger's COSMIC

The mutation data was obtained from the Sanger Institute Catalogue Of Somatic Mutations In Cancer web site, http://www.sanger.ac.uk/cosmic Bamford et al (2004) The COSMIC (Catalogue of Somatic Mutations in Cancer) database and website. Br J Cancer, 91,355-358.
Mutation (top 10)Total Observations
c.1228G>A1
c.727G>C1
c.870G>A1
Primary Site / Histology (Top 10)Mutations (sites * observations)
lung / carcinoma1
skin / malignant melanoma1
central nervous system / glioma1

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
3,4,5,3',4',5'-hexachlorobiphenyl
  • 3,4,5,3',4',5'-hexachlorobiphenyl results in increased expression of FYN mRNA
16050139
Acetaminophen
  • Acetaminophen affects the expression of FYN mRNA
17562736
alachlor
  • alachlor results in increased expression of FYN mRNA
12419858
Benzo(a)pyrene
  • Benzo(a)pyrene results in increased expression of FYN mRNA
16050139
bisindolylmaleimide I
  • bisindolylmaleimide I does not affect the reaction [Lead results in increased activity of FYN protein]
  • bisindolylmaleimide I does not affect the reaction [Methylmercury Compounds results in increased activity of FYN protein]
  • bisindolylmaleimide I does not affect the reaction [Paraquat results in increased activity of FYN protein]
  • bisindolylmaleimide I does not affect the reaction [lead acetate results in increased activity of FYN protein]
17298174
Carmustine
  • Carmustine results in decreased expression of FYN mRNA
15980968
Cyclophosphamide
  • Cyclophosphamide results in increased expression of FYN mRNA
17403535
decitabine
  • decitabine results in increased expression of FYN mRNA
16367923
gluconic acid
  • gluconic acid results in decreased expression of FYN mRNA
16556975
Lead
  • FYN protein affects the reaction [Lead results in decreased expression of PDGFRA protein]
  • Lead results in increased activity of FYN protein
  • bisindolylmaleimide I does not affect the reaction [Lead results in increased activity of FYN protein]
17298174
lead acetate
  • FYN protein affects the reaction [lead acetate results in decreased expression of PDGFRA protein]
  • bisindolylmaleimide I does not affect the reaction [lead acetate results in increased activity of FYN protein]
  • lead acetate results in increased activity of FYN protein
17298174
Methylmercury Compounds
  • FYN protein affects the reaction [Methylmercury Compounds results in increased ubiquitination of and results in increased degradation of PDGFRA protein]
  • Methylmercury Compounds results in increased activity of FYN protein
  • bisindolylmaleimide I does not affect the reaction [Methylmercury Compounds results in increased activity of FYN protein]
17298174
Methylnitronitrosoguanidine
  • Methylnitronitrosoguanidine results in increased expression of FYN mRNA
12634122
nickel sulfate
  • nickel sulfate results in increased expression of FYN mRNA
16780908
Paraquat
  • FYN protein affects the reaction [Paraquat results in decreased expression of PDGFRA protein]
  • Paraquat results in increased activity of FYN protein
  • bisindolylmaleimide I does not affect the reaction [Paraquat results in increased activity of FYN protein]
17298174
Paraquat
  • Paraquat affects the expression of FYN mRNA
15206577
sodium arsenite
  • sodium arsenite results in increased expression of FYN mRNA
12016162
sodium arsenite
  • sodium arsenite results in increased expression of FYN mRNA
16014739

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Stomach Neoplasms marker 16367923
Adrenal Gland Neoplasms inferred via sodium arsenite 15276417
Adrenocortical Adenoma inferred via sodium arsenite 16712894
Carcinoma, Hepatocellular inferred via sodium arsenite 15276417, 16507464
Carcinoma, Squamous Cell inferred via sodium arsenite 18572023
Genital Neoplasms, Female inferred via sodium arsenite 16452187
Hodgkin Disease inferred via sodium arsenite 12676792
Liver Neoplasms inferred via sodium arsenite 15276417, 16712894
Lung Neoplasms inferred via sodium arsenite 15276417, 16712894, 17077188
Melanoma inferred via sodium arsenite 16487513
Neoplasms inferred via sodium arsenite 11559025
Neural Tube Defects inferred via sodium arsenite 12854658
Ovarian Neoplasms inferred via sodium arsenite 15276417
Prostatic Neoplasms inferred via sodium arsenite 16039940
Skin Neoplasms inferred via sodium arsenite 18572023
Spinal Dysraphism inferred via sodium arsenite 12854658
Urinary Bladder Neoplasms inferred via sodium arsenite 11723127, 16452187, 16712894
Uterine Cervical Neoplasms inferred via sodium arsenite 11813266
Vascular Diseases inferred via sodium arsenite 17056641
Agricultural Workers' Diseases inferred via Paraquat 11874814
Gliosis inferred via Paraquat 11124998
Nerve Degeneration inferred via Paraquat 16893418
Parkinson Disease inferred via Paraquat 12911755, 15824117, 11181820, 11445065, 16510128, 15451049, 11124998, 16140633
Pneumonia inferred via Paraquat 12504350
Pulmonary Fibrosis inferred via Paraquat 16324872, 17997886
Respiratory Distress Syndrome, Adult inferred via Paraquat 11700416
Respiratory Sounds inferred via Paraquat 11874814
Retinal Degeneration inferred via Paraquat 16458197
Dermatitis, Allergic Contact inferred via nickel sulfate 16780908
Microsatellite Instability inferred via Methylnitronitrosoguanidine 17671175
Dementia inferred via Methylmercury Compounds 16140633
Dementia inferred via Lead 16140633
Essential Tremor inferred via Lead 18007985
Infertility, Male inferred via Lead 16780224
Lead Poisoning inferred via Lead 16700817
Learning Disorders inferred via Lead 16384672
Memory Disorders inferred via Lead 17263510, 16384672
Prenatal Exposure Delayed Effects inferred via Lead 16384672
Arteriosclerosis inferred via Cyclophosphamide 15014928
Breast Neoplasms inferred via Cyclophosphamide 17388661, 18234424, 12006526, 16978400, 11325840, 18323546, 15093573, 15136595
Carcinoma, Lewis Lung inferred via Cyclophosphamide 16152834
Carcinoma, Renal Cell inferred via Cyclophosphamide 16201981
Cystitis inferred via Cyclophosphamide 11948286, 18433785, 15276878, 18710439, 12913760, 16651033, 16989017, 12388444, 10498854, 15643279, 18483878, 17979934, 16413132, 10700343, 16614059, 18295254, 17010015
Diabetes Mellitus, Experimental inferred via Cyclophosphamide 11751995, 10990075, 15331540
Diabetes Mellitus, Type 1 inferred via Cyclophosphamide 18772604
Eosinophilia inferred via Cyclophosphamide 11006010
Gliosarcoma inferred via Cyclophosphamide 11389073
GLOBOZOOSPERMIA inferred via Cyclophosphamide 16517039
Graft vs Host Disease inferred via Cyclophosphamide 11014644, 16376943, 15172196
Hemophilia A inferred via Cyclophosphamide 11918545
Hepatic Veno-Occlusive Disease inferred via Cyclophosphamide 14986274
Hodgkin Disease inferred via Cyclophosphamide 17606976, 16135485
Infertility, Male inferred via Cyclophosphamide 16517039
Leukemia inferred via Cyclophosphamide 10602166
Leukemia, Lymphocytic, Chronic, B-Cell inferred via Cyclophosphamide 18587576, 17658394, 17008537, 18172266, 17802794, 17296974
Leukopenia inferred via Cyclophosphamide 10052129, 11830472
Lymphoma inferred via Cyclophosphamide 12854902
Lymphoma, B-Cell inferred via Cyclophosphamide 16675587
Lymphoma, Non-Hodgkin inferred via Cyclophosphamide 11911406
Melanoma, Experimental inferred via Cyclophosphamide 16388313
Neuroblastoma inferred via Cyclophosphamide 16115947, 15176712
Oligospermia inferred via Cyclophosphamide 16517039
Pancreatic Neoplasms inferred via Cyclophosphamide 11332152
Prostatic Neoplasms inferred via Cyclophosphamide 17136230
Pulmonary Fibrosis inferred via Cyclophosphamide 16636934
Scleroderma, Systemic inferred via Cyclophosphamide 16636934
Urinary Bladder Neoplasms inferred via Cyclophosphamide 14692829
Brain Neoplasms inferred via Carmustine 16187019
Glioblastoma inferred via Carmustine 16187019
Melanoma inferred via Carmustine 12393984
Esophageal Neoplasms inferred via Benzo(a)pyrene 16530937
Lung Neoplasms inferred via Benzo(a)pyrene 17053015
Urinary Bladder Neoplasms inferred via Benzo(a)pyrene 17053015
Agricultural Workers' Diseases inferred via alachlor 11874814, 14769641
Dermatitis, Allergic Contact inferred via alachlor 8428444
Infertility, Male inferred via alachlor 16466525, 17049205, 12948887
Leukemia inferred via alachlor 14769641
Multiple Myeloma inferred via alachlor 14769641
Nose Neoplasms inferred via alachlor 16698726, 16178123, 11127290, 14563481, 15580706
Respiratory Sounds inferred via alachlor 11874814
Thyroid Neoplasms inferred via alachlor 8812207
Hepatitis, Toxic inferred via Acetaminophen 2444490, 16081117, 17522070, 14986274, 16227642, 15968718, 16177239, 17562736
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
ADAM15 FYN / ADAM15 Reconstituted Complex Poghosyan Z (2002)
ADD2 FYN / ADD2 Affinity Capture-Western Shima T (2001)
ADD2 FYN / ADD2 Reconstituted Complex Shima T (2001)
BCAR1 BCAR1 / FYN Affinity Capture-Western Manie SN (1997)
BCAR1 BCAR1 / FYN Reconstituted Complex Manie SN (1997)
BCAR1 BCAR1 / FYN Two-hybrid Donaldson JC (2000)
BCL3 FYN / BCL3 Reconstituted Complex Weyrich AS (1998)
BTK BTK / FYN Reconstituted Complex Cheng G (1994)
CBL FYN / CBL Affinity Capture-Western Deckert M (1998)
CBL FYN / CBL Affinity Capture-Western Taher TE (2002)
CBL FYN / CBL Reconstituted Complex Deckert M (1998)
CBL FYN / CBL Two-hybrid Deckert M (1998)
CBLC CBLC / FYN Affinity Capture-Western Kim M (1999)
CBLC FYN / CBLC Reconstituted Complex Kim M (1999)
CD2 CD2 / FYN Reconstituted Complex Lin H (1998)
CD226 CD226 / FYN Affinity Capture-Western Shibuya K (1999)
CD36 FYN / CD36 Affinity Capture-Western Bull HA (1994)
CD36 CD36 / FYN Affinity Capture-Western Huang MM (1991)
CD44 CD44 / FYN Affinity Capture-Western Ilangumaran S (1998)
CD44 CD44 / FYN Co-fractionation Ilangumaran S (1998)
CDC2 FYN / CDC2 Affinity Capture-Western Pathan NI (1996)
CDH1 FYN / CDH1 Affinity Capture-Western Piedra J (2003)
CDH1 CDH1 / FYN Reconstituted Complex Piedra J (2003)
CHRNA7 CHRNA7 / FYN Affinity Capture-Western Kihara T (2001)
CHRNA7 FYN / CHRNA7 Affinity Capture-Western Kihara T (2001)
CNTN1 FYN / CNTN1 Invivo Olive S (1995)
CSF1R CSF1R / FYN Affinity Capture-Western Courtneidge SA (1993)
CSF1R CSF1R / FYN Reconstituted Complex Courtneidge SA (1993)
CSF1R FYN / CSF1R Reconstituted Complex Courtneidge SA (1993)
CSK CSK / FYN Affinity Capture-Western Takeuchi M (1993)
CTLA4 CTLA4 / FYN Affinity Capture-Western Miyatake S (1998)
CTNNB1 FYN / CTNNB1 Biochemical Activity Piedra J (2003)
CTNND1 CTNND1 / FYN Affinity Capture-Western Piedra J (2003)
CTNND1 FYN / CTNND1 Affinity Capture-Western Piedra J (2003)
CTNND1 FYN / CTNND1 Biochemical Activity Martinez MC (2003)
DAG1 DAG1 / FYN Affinity Capture-Western Sotgia F (2001)
DAG1 DAG1 / FYN Reconstituted Complex Sotgia F (2001)
DLG4 DLG4 / FYN Affinity Capture-Western Hou XY (2002)
DLG4 FYN / DLG4 Affinity Capture-Western Hou XY (2002)
DLG4 FYN / DLG4 Affinity Capture-Western Tezuka T (1999)
Efs Efs / FYN Reconstituted Complex Ohba T (1998)
Efs FYN / Efs Reconstituted Complex Ohba T (1998)
EPHA4 FYN / EPHA4 Affinity Capture-Western Prevost N (2002)
EPHA8 EPHA8 / FYN Affinity Capture-Western Choi S (1999)
EPHA8 EPHA8 / FYN Reconstituted Complex Choi S (1999)
EPHB3 FYN / EPHB3 Reconstituted Complex Hock B (1998)
FAS FYN / FAS Affinity Capture-Western Atkinson EA (1996)
FASLG FYN / FASLG Reconstituted Complex Hane M (1995)
FASLG FASLG / FYN Reconstituted Complex Wenzel J (2001)
FNBP4 FNBP4 / FYN Reconstituted Complex Bedford MT (2000)
FYB FYN / FYB Affinity Capture-Western da Silva AJ (1993)
FYB FYN / FYB Reconstituted Complex da Silva AJ (1993)
FYN FYN / FYN Co-crystal Structure Noble ME (1993)
GAB3 FYN / GAB3 Reconstituted Complex Wolf I (2002)
GNB2L1 FYN / GNB2L1 Affinity Capture-Western Yaka R (2002)
GNB2L1 GNB2L1 / FYN Affinity Capture-Western Yaka R (2003)
GNB2L1 FYN / GNB2L1 Reconstituted Complex Yaka R (2002)
GP6 GP6 / FYN Reconstituted Complex Suzuki-Inoue K (2002)
GRB10 FYN / GRB10 Biochemical Activity Langlais P (2000)
GRIN2A FYN / GRIN2A Affinity Capture-Western Hou XY (2002)
GRIN2A GRIN2A / FYN Affinity Capture-Western Hou XY (2002)
GRIN2A FYN / GRIN2A Affinity Capture-Western Ma J (2003)
GRIN2A GRIN2A / FYN Affinity Capture-Western Takagi N (1999)
GRIN2A FYN / GRIN2A Affinity Capture-Western Tezuka T (1999)
GRIN2A GRIN2A / FYN Reconstituted Complex Takagi N (1999)
GRIN2B GRIN2B / FYN Reconstituted Complex Takagi N (1999)
IL7R IL7R / FYN Affinity Capture-Western Seckinger P (1994)
ITK ITK / FYN Reconstituted Complex Bunnell SC (1996)
ITK ITK / FYN Reconstituted Complex Bunnell SC (2000)
JAK2 FYN / JAK2 Affinity Capture-Western Sayeski PP (1999)
JAK2 FYN / JAK2 Reconstituted Complex Sayeski PP (1999)
KHDRBS1 KHDRBS1 / FYN Affinity Capture-Western Fusaki N (1997)
KHDRBS1 FYN / KHDRBS1 Reconstituted Complex Oneyama C (2002)
MAG MAG / FYN Reconstituted Complex Jaramillo ML (1994)
MAP2 MAP2 / FYN Affinity Capture-Western Zamora-Leon SP (2001)
MAPT FYN / MAPT Affinity Capture-Western Klein C (2002)
MAPT FYN / MAPT Reconstituted Complex Klein C (2002)
MCAM MCAM / FYN Affinity Capture-Western Anfosso F (1998)
MS4A1 MS4A1 / FYN Affinity Capture-Western Deans JP (1995)
Mta1 FYN / Mta1 Reconstituted Complex Simpson A (2001)
Mta1 Mta1 / FYN Reconstituted Complex Simpson A (2001)
Mta3 FYN / Mta3 Reconstituted Complex Simpson A (2001)
NEDD9 NEDD9 / FYN Affinity Capture-Western Tachibana K (1997)
NMT1 FYN / NMT1 Biochemical Activity Rajala RV (2001)
NPHS1 NPHS1 / FYN Affinity Capture-Western Lahdenpera J (2003)
NPHS1 FYN / NPHS1 Affinity Capture-Western Verma R (2003)
NPHS1 NPHS1 / FYN Affinity Capture-Western Verma R (2003)
NPHS1 FYN / NPHS1 Biochemical Activity Verma R (2003)
NPHS1 FYN / NPHS1 Reconstituted Complex Verma R (2003)
NTRK2 NTRK2 / FYN Affinity Capture-Western Iwasaki Y (1998)
NTRK2 FYN / NTRK2 Reconstituted Complex Iwasaki Y (1998)
PAG1 PAG1 / FYN Affinity Capture-Western Brdicka T (2000)
PAG1 FYN / PAG1 Reconstituted Complex Brdicka T (2000)
PECAM1 FYN / PECAM1 Affinity Capture-Western Cicmil M (2000)
PIK3R1 FYN / PIK3R1 Reconstituted Complex Kapeller R (1994)
PIK3R2 FYN / PIK3R2 Biochemical Activity Gout I (1992)
PIK3R2 FYN / PIK3R2 Reconstituted Complex Gout I (1992)
PLCG2 FYN / PLCG2 Reconstituted Complex Pleiman CM (1993)
PRKCQ FYN / PRKCQ Affinity Capture-Western Ron D (1999)
PRKCQ PRKCQ / FYN Affinity Capture-Western Ron D (1999)
PRKCQ FYN / PRKCQ Biochemical Activity Ron D (1999)
PRKCQ FYN / PRKCQ Reconstituted Complex Ron D (1999)
PRKCQ PRKCQ / FYN Reconstituted Complex Ron D (1999)
PRKCQ PRKCQ / FYN Two-hybrid Ron D (1999)
PTK2 PTK2 / FYN Affinity Capture-Western Messina S (2003)
PTK2 PTK2 / FYN Co-crystal Structure Arold ST (2001)
PTK2B PTK2B / FYN Affinity Capture-Western Ganju RK (1997)
PTK2B FYN / PTK2B Affinity Capture-Western Qian D (1997)
PTK2B FYN / PTK2B Biochemical Activity Qian D (1997)
PTK2B PTK2B / FYN Reconstituted Complex Katagiri T (2000)
PTPN11 FYN / PTPN11 Affinity Capture-Western Tang H (1999)
PTPN5 FYN / PTPN5 Affinity Capture-Western Nguyen TH (2002)
PTPRA FYN / PTPRA Affinity Capture-Western Bhandari V (1998)
PXN PXN / FYN Affinity Capture-Western Chen LM (2000)
RAF1 FYN / RAF1 Affinity Capture-Western Cleghon V (1994)
RAF1 FYN / RAF1 Reconstituted Complex Cleghon V (1994)
RICS RICS / FYN Affinity Capture-Western Taniguchi S (2003)
RICS RICS / FYN Reconstituted Complex Taniguchi S (2003)
RICS FYN / RICS Two-hybrid Taniguchi S (2003)
RPL10 FYN / RPL10 Reconstituted Complex Oh HS (2002)
SCAP1 FYN / SCAP1 Affinity Capture-Western Wu L (2002)
SCAP1 FYN / SCAP1 Reconstituted Complex Marie-Cardine A (1997)
SCAP2 FYN / SCAP2 Affinity Capture-Western Kouroku Y (1998)
SDC3 SDC3 / FYN Reconstituted Complex Kinnunen T (1998)
SH2D1A SH2D1A / FYN Affinity Capture-Western Li C (2003)
SH2D1A FYN / SH2D1A Reconstituted Complex Chan B (2003)
SH2D1A SH2D1A / FYN Reconstituted Complex Li C (2003)
SH3BP2 FYN / SH3BP2 Two-hybrid Deckert M (1998)
SIT1 SIT1 / FYN Affinity Capture-Western Marie-Cardine A (1999)
SLAMF1 FYN / SLAMF1 Reconstituted Complex Chan B (2003)
SNCA FYN / SNCA Biochemical Activity Nakamura T (2001)
SOCS1 FYN / SOCS1 Reconstituted Complex De Sepulveda P (1999)
SOS1 SOS1 / FYN Reconstituted Complex Park C (1998)
SRC SRC / FYN Protein-peptide Pirozzi G (1997)
SYK FYN / SYK Affinity Capture-Western Deckert M (1998)
SYK FYN / SYK Reconstituted Complex Deckert M (1998)
THY1 THY1 / FYN Affinity Capture-Western Thomas PM (1992)
TNK2 FYN / TNK2 Affinity Capture-Western Linseman DA (2001)
TNK2 FYN / TNK2 Reconstituted Complex Linseman DA (2001)
TOM1L1 FYN / TOM1L1 Reconstituted Complex Seykora JT (2002)
TRAT1 FYN / TRAT1 Reconstituted Complex Brdicka T (2000)
TRPC6 FYN / TRPC6 Affinity Capture-Western Hisatsune C (2004)
TRPC6 TRPC6 / FYN Affinity Capture-Western Hisatsune C (2004)
TRPC6 FYN / TRPC6 Biochemical Activity Hisatsune C (2004)
TRPC6 FYN / TRPC6 Reconstituted Complex Hisatsune C (2004)
TRPV4 TRPV4 / FYN Affinity Capture-Western Xu H (2003)
TUBA2 FYN / TUBA2 Affinity Capture-Western Klein C (2002)
TUBA2 FYN / TUBA2 Reconstituted Complex Klein C (2002)
TYK2 FYN / TYK2 Affinity Capture-Western Uddin S (1997)
TYK2 FYN / TYK2 Reconstituted Complex Uddin S (1997)
UNC119 FYN / UNC119 Affinity Capture-Western Gorska MM (2004)
UNC119 UNC119 / FYN Reconstituted Complex Gorska MM (2004)
VAV1 FYN / VAV1 Affinity Capture-Western Michel F (1998)
WAS FYN / WAS Affinity Capture-Western Banin S (1996)
WAS WAS / FYN Affinity Capture-Western Banin S (1996)
WAS FYN / WAS Reconstituted Complex Banin S (1996)
WAS WAS / FYN Reconstituted Complex Banin S (1999)
YES1 YES1 / FYN Affinity Capture-Western Piedra J (2003)
YT521 FYN / YT521 Biochemical Activity Rafalska I (2004)
ZAP70 ZAP70 / FYN Affinity Capture-Western Neumeister EN (1995)
ZAP70 ZAP70 / FYN Phenotypic Enhancement Neumeister EN (1995)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Sato I, et al. (2009) "Differential trafficking of Src, Lyn, Yes and Fyn is specified by the state of palmitoylation in the SH4 domain." J Cell Sci. 122(Pt 7):965-975. PMID:19258394
  2. [ + ] Szczepankiewicz A, et al. (2009) "The association study of three FYN polymorphisms with prophylactic lithium response in bipolar patients." Hum Psychopharmacol. 24(4):287-291. PMID:19330793
  3. [ + ] Riento K, et al. (2009) "Endocytosis of flotillin-1 and flotillin-2 is regulated by Fyn kinase." J Cell Sci. 122(Pt 7):912-918. PMID:19258392
  4. [ + ] Gao Y, et al. (2009) "Oxidative stress promotes transcriptional up-regulation of Fyn in BCR-ABL1-expressing cells." J Biol Chem. 284(11):7114-7125. PMID:19131339
  5. [ + ] Kozlowska A, et al. (2008) "Inhibition of DNA methyltransferase activity upregulates Fyn tyrosine kinase expression in Hut-78 T-lymphoma cells." Biomed Pharmacother. 62(10):672-676. PMID:18337055
  6. [ + ] Sorensen KD, et al. (2008) "Chromosomal deletion, promoter hypermethylation and downregulation of FYN in prostate cancer." Int J Cancer. 122(3):509-519. PMID:17943724
  7. [ + ] Ban K, et al. (2008) "BCR-ABL1 mediates up-regulation of Fyn in chronic myelogenous leukemia." Blood. 111(5):2904-2908. PMID:18180382
  8. [ + ] Pastor IJ, et al. (2008) "Genetic association between -93A/G polymorphism in the Fyn kinase gene and alcohol dependence in Spanish men." Eur Psychiatry. ():. PMID:18849153
  9. [ + ] Miyagawa H, et al. (2008) "Association of polymorphisms in complement component C3 gene with susceptibility to systemic lupus erythematosus." Rheumatology (Oxford). 47(2):158-164. PMID:18174230
  10. [ + ] Szczepankiewicz A, et al. (2008) "Association analysis of tyrosine kinase FYN gene polymorphisms in asthmatic children." Int Arch Allergy Immunol. 145(1):43-47. PMID:17703099
  11. [ + ] Saksena S, et al. (2008) "Role of Fyn and PI3K in H2O2-induced inhibition of apical Cl-/OH- exchange activity in human intestinal epithelial cells." Biochem J. 416(1):99-108. PMID:18564062
  12. [ + ] Li Y, et al. (2008) "Neither replication nor simulation supports a role for the axon guidance pathway in the genetics of Parkinson's disease." PLoS ONE. 3(7):e2707. PMID:18628988
  13. [ + ] Hoe HS, et al. (2008) "Fyn modulation of Dab1 effects on amyloid precursor protein and ApoE receptor 2 processing." J Biol Chem. 283(10):6288-6299. PMID:18089558
  14. [ + ] Vieira AR, et al. (2008) "Candidate gene/loci studies in cleft lip/palate and dental anomalies finds novel susceptibility genes for clefts." Genet Med. 10(9):668-674. PMID:18978678
  15. [ + ] Solheim SA, et al. (2008) "Regulation of FynT function by dual domain docking on PAG/Cbp." J Biol Chem. 283(5):2773-2783. PMID:18056706
  16. [ + ] Chiu YJ, et al. (2008) "Mechanotransduction in an extracted cell model: Fyn drives stretch- and flow-elicited PECAM-1 phosphorylation." J Cell Biol. 182(4):753-763. PMID:18710921
  17. [ + ] Shelton H, et al. (2008) "Hepatitis C virus NS5A protein binds the SH3 domain of the Fyn tyrosine kinase with high affinity: mutagenic analysis of residues within the SH3 domain that contribute to the interaction." Virol J. 5():24. PMID:18267011
  18. [ + ] Wagner MC, et al. (2008) "Ischemic injury to kidney induces glomerular podocyte effacement and dissociation of slit diaphragm proteins Neph1 and ZO-1." J Biol Chem. 283(51):35579-35589. PMID:18922801
  19. [ + ] Ilic V, et al. (2007) "Signaling status of IgG B cell receptor (IgG BCR) is indicative for an activated state of circulating B cells in multiple myeloma." Ann Hematol. 86(12):905-912. PMID:17701175
  20. [ + ] Grabulovski D, et al. (2007) "A novel, non-immunogenic Fyn SH3-derived binding protein with tumor vascular targeting properties." J Biol Chem. 282(5):3196-3204. PMID:17130124
  21. [ + ] Clarkson NG, et al. (2007) "Direct and indirect interactions of the cytoplasmic region of CD244 (2B4) in mice and humans with FYN kinase." J Biol Chem. 282(35):25385-25394. PMID:17599905
  22. [ + ] Rybakowski JK, et al. (2007) "Polymorphisms of the Fyn kinase gene and a performance on the Wisconsin Card Sorting Test in schizophrenia." Psychiatr Genet. 17(3):201-204. PMID:17417065
  23. [ + ] Wissing J, et al. (2007) "Proteomics analysis of protein kinases by target class-selective prefractionation and tandem mass spectrometry." Mol Cell Proteomics. 6(3):537-547. PMID:17192257
  24. [ + ] Yamada Y, et al. (2007) "Association of gene polymorphisms with blood pressure and the prevalence of hypertension in community-dwelling Japanese individuals." Int J Mol Med. 19(4):675-683. PMID:17334644
  25. [ + ] Sawada Y, et al. (2006) "Force sensing by mechanical extension of the Src family kinase substrate p130Cas." Cell. 127(5):1015-1026. PMID:17129785
  26. [ + ] Lowenberg M, et al. (2006) "Glucocorticoids cause rapid dissociation of a T-cell-receptor-associated protein complex containing LCK and FYN." EMBO Rep. 7(10):1023-1029. PMID:16888650
  27. [ + ] Angelini DJ, et al. (2006) "TNF-alpha increases tyrosine phosphorylation of vascular endothelial cadherin and opens the paracellular pathway through fyn activation in human lung endothelia." Am J Physiol Lung Cell Mol Physiol. 291(6):L1232-L1245. PMID:16891393
  28. [ + ] Kinoshita T, et al. (2006) "Structure of human Fyn kinase domain complexed with staurosporine." Biochem Biophys Res Commun. 346(3):840-844. PMID:16782058
  29. [ + ] Kostic A, et al. (2006) "Fibronectin rigidity response through Fyn and p130Cas recruitment to the leading edge." Mol Biol Cell. 17(6):2684-2695. PMID:16597701
  30. [ + ] Bachelet I, et al. (2006) "Mast cell costimulation by CD226/CD112 (DNAM-1/Nectin-2): a novel interface in the allergic process." J Biol Chem. 281(37):27190-27196. PMID:16831868
  31. [ + ] Rajagopal R, et al. (2006) "A role for Fyn in Trk receptor transactivation by G-protein-coupled receptor signaling." Mol Cell Neurosci. 33(1):36-46. PMID:16860569
  32. [ + ] Stove V, et al. (2006) "Modelling thymic HIV-1 Nef effects." Curr HIV Res. 4(1):57-64. PMID:16454711
  33. [ + ] Liu H, et al. (2006) "Physical and functional interaction of Fyn tyrosine kinase with a brain-enriched Rho GTPase-activating protein TCGAP." J Biol Chem. 281(33):23611-23619. PMID:16777849
  34. [ + ] Lim J, et al. (2006) "A protein-protein interaction network for human inherited ataxias and disorders of Purkinje cell degeneration." Cell. 125(4):801-814. PMID:16713569
  35. [ + ] Laplante P, et al. (2006) "Perlecan proteolysis induces an alpha2beta1 integrin- and Src family kinase-dependent anti-apoptotic pathway in fibroblasts in the absence of focal adhesion kinase activation." J Biol Chem. 281(41):30383-30392. PMID:16882656
  36. [ + ] Okabe S, et al. (2006) "Stromal-cell-derived factor-1/CXCL12-induced chemotaxis of a T cell line involves intracellular signaling through Cbl and Cbl-b and their regulation by Src kinases and CD45." Blood Cells Mol Dis. 36(2):308-314. PMID:16503409
  37. [ + ] Paccani SR, et al. (2005) "Nonsteroidal anti-inflammatory drugs inhibit a Fyn-dependent pathway coupled to Rac and stress kinase activation in TCR signaling." Blood. 105(5):2042-2048. PMID:15514010
  38. [ + ] Foucault I, et al. (2005) "The adaptor protein 3BP2 associates with VAV guanine nucleotide exchange factors to regulate NFAT activation by the B-cell antigen receptor." Blood. 105(3):1106-1113. PMID:15345594
  39. [ + ] Okabe S, et al. (2005) "Stromal cell-derived factor-1alpha/CXCL12-induced chemotaxis of T cells involves activation of the RasGAP-associated docking protein p62Dok-1." Blood. 105(2):474-480. PMID:15345598
  40. [ + ] Zamora-Leon SP, et al. (2005) "Fyn phosphorylates human MAP-2c on tyrosine 67." J Biol Chem. 280(3):1962-1970. PMID:15536091
  41. [ + ] He Z, et al. (2005) "Regulation of ultraviolet B-induced phosphorylation of histone H3 at serine 10 by Fyn kinase." J Biol Chem. 280(4):2446-2454. PMID:15537652
  42. [ + ] Bhaskar K, et al. (2005) "Disease-related modifications in tau affect the interaction between Fyn and Tau." J Biol Chem. 280(42):35119-35125. PMID:16115884
  43. [ + ] Derkinderen P, et al. (2005) "Tyrosine 394 is phosphorylated in Alzheimer's paired helical filament tau and in fetal tau with c-Abl as the candidate tyrosine kinase." J Neurosci. 25(28):6584-6593. PMID:16014719
  44. [ + ] Zamora-Leon SP, et al. (2005) "Disruption of the actin network enhances MAP-2c and Fyn-induced process outgrowth." Cell Motil Cytoskeleton. 62(2):110-123. PMID:16145685
  45. [ + ] Xie Z, et al. (2005) "Calcium-induced human keratinocyte differentiation requires src- and fyn-mediated phosphatidylinositol 3-kinase-dependent activation of phospholipase C-gamma1." Mol Biol Cell. 16(7):3236-3246. PMID:15872086
  46. [ + ] Kanda S, et al. (2005) "Pigment epithelium-derived factor inhibits fibroblast-growth-factor-2-induced capillary morphogenesis of endothelial cells through Fyn." J Cell Sci. 118(Pt 5):961-970. PMID:15713745
  47. [ + ] Pariser H, et al. (2005) "Fyn is a downstream target of the pleiotrophin/receptor protein tyrosine phosphatase beta/zeta-signaling pathway: regulation of tyrosine phosphorylation of Fyn by pleiotrophin." Biochem Biophys Res Commun. 332(3):664-669. PMID:15925565
  48. [ + ] Chin J, et al. (2005) "Fyn kinase induces synaptic and cognitive impairments in a transgenic mouse model of Alzheimer's disease." J Neurosci. 25(42):9694-9703. PMID:16237174
  49. [ + ] Puertollano R, et al. (2005) "Interactions of TOM1L1 with the multivesicular body sorting machinery." J Biol Chem. 280(10):9258-9264. PMID:15611048