Abcd3 | GeneID:25270 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 25270 Official Symbol Abcd3
Locus N/A Gene Type protein-coding
Synonyms PMP70; Pxmp1
Full Name ATP-binding cassette, sub-family D (ALD), member 3
Description ATP-binding cassette, sub-family D (ALD), member 3
Chromosome 2q41
Also Known As 70-kDa peroxisomal membrane protein; Peroxisomal membrane protein 1
Summary may form an ATP binding channel; may play a role in active transport in peroxisomes [RGD]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 2140

ID Symbol Protein Species
GeneID:5825 ABCD3 NP_002849.1 Homo sapiens
GeneID:19299 Abcd3 NP_033017.2 Mus musculus
GeneID:25270 Abcd3 NP_036936.1 Rattus norvegicus
GeneID:32992 CG12703 NP_608354.1 Drosophila melanogaster
GeneID:174126 pmp-1 NP_495407.1 Caenorhabditis elegans
GeneID:174127 pmp-2 NP_495408.1 Caenorhabditis elegans
GeneID:406803 abcd3a NP_998647.1 Danio rerio
GeneID:424487 ABCD3 NP_001012615.1 Gallus gallus
GeneID:457037 ABCD3 XP_513575.2 Pan troglodytes
GeneID:479939 ABCD3 XP_537064.2 Canis lupus familiaris
GeneID:526059 ABCD3 XP_604418.3 Bos taurus
GeneID:830144 PXA1 NP_568072.1 Arabidopsis thaliana
GeneID:1271802 AgaP_AGAP000440 XP_310656.2 Anopheles gambiae
GeneID:4337574 Os05g0107600 NP_001054425.1 Oryza sativa

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab3421 PMP70 antibody - Peroxisomal Membrane Marker (ab3421); Rabbit polyclonal to PMP70 - Peroxisomal Membrane Marker
2 abcam ab28499 PMP70 antibody (Biotin) (ab28499); Rabbit polyclonal to PMP70 - Peroxisomal Membrane Marker (Biotin)
3 sigma P0497 Anti-PMP70 antibody produced in rabbit ;
4 sigma P0090 Anti-PMP70−Atto 488 antibody produced in rabbit ;

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0005743 Component mitochondrial inner membrane
GO:0005739 Component mitochondrion
GO:0005778 Component peroxisomal membrane
GO:0005777 Component peroxisome
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0005515 Function protein binding
GO:0043621 Function protein self-association
GO:0015910 Process peroxisomal long-chain fatty acid import
GO:0042221 Process response to chemical stimulus
GO:0042493 Process response to drug
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_012804  UCSC Browser NP_036936

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000016739 MI0003186 hsa-miR-502-3p AAUGCACCUGGGCAAGGAUUCA
ENSRNOT00000016739 MI0004553 mmu-miR-666-5p AGCGGGCACAGCUGUGAGAGCC
ENSRNOT00000016739 MI0004652 mmu-miR-687 CUAUCCUGGAAUGCAGCAAUGA
ENSRNOT00000016739 MI0000616 rno-miR-148b-3p UCAGUGCAUCACAGAACUUUGU
ENSRNOT00000016739 MI0003483 rno-miR-224 CAAGUCACUAGUGGUUCCGUUUA
ENSRNOT00000016739 MI0000970 rno-miR-299 UGGUUUACCGUCCCACAUACAU
ENSRNOT00000016739 MI0000639 rno-miR-350 UUCACAAAGCCCAUACACUUUCAC
ENSRNOT00000016739 MI0006146 rno-miR-425 AAUGACACGAUCACUCCCGUUGA
ENSRNOT00000016739 MI0006114 rno-miR-466c UGUGAUGUGUGCAUGUACAUG
ENSRNOT00000016739 MI0003524 rno-miR-540 AGGUCAGAGGUCGAUCCUGG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

D90038   NM_012804  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Di Benedetto R, et al. (2009) "PMP70 knock-down generates oxidative stress and pro-inflammatory cytokine production in C6 glial cells." Neurochem Int. 54(1):37-42. PMID:18992293
  2. [ + ] Di Benedetto R, et al. (2008) "RNAi-mediated silencing of ABCD3 gene expression in rat C6 glial cells: a model system to study PMP70 function." Neurochem Int. 52(6):1106-1113. PMID:18178290
  3. [ + ] Kwitek AE, et al. (2004) "High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence." Genome Res. 14(4):750-757. PMID:15060019
  4. [ + ] Kashiwayama Y, et al. (2002) "Nucleotide-induced conformational changes of PMP70, an ATP binding cassette transporter on rat liver peroxisomal membranes." Biochem Biophys Res Commun. 291(5):1245-1251. PMID:11883951
  5. [ + ] Tanaka AR, et al. (2002) "ATP binding/hydrolysis by and phosphorylation of peroxisomal ATP-binding cassette proteins PMP70 (ABCD3) and adrenoleukodystrophy protein (ABCD1)." J Biol Chem. 277(42):40142-40147. PMID:12176987
  6. [ + ] Wilcke M, et al. (2001) "Differential induction of peroxisomal populations in subcellular fractions of rat liver." Biochim Biophys Acta. 1544(1-2):358-369. PMID:11341945
  7. [ + ] Gouveia AM, et al. (1999) "Alkaline density gradient floatation of membranes: polypeptide composition of the mammalian peroxisomal membrane." Anal Biochem. 274(2):270-277. PMID:10527525
  8. [ + ] Albet S, et al. (1997) "Fenofibrate differently alters expression of genes encoding ATP-binding transporter proteins of the peroxisomal membrane." FEBS Lett. 405(3):394-397. PMID:9108325
  9. [ + ] Kamijo K, et al. (1990) "The 70-kDa peroxisomal membrane protein is a member of the Mdr (P-glycoprotein)-related ATP-binding protein superfamily." J Biol Chem. 265(8):4534-4540. PMID:1968461