Abcd3 | GeneID:25270 | Rattus norvegicus
Gene Summary
[
] NCBI Entrez Gene
| Gene ID | 25270 | Official Symbol | Abcd3 |
|---|---|---|---|
| Locus | N/A | Gene Type | protein-coding |
| Synonyms | PMP70; Pxmp1 | ||
| Full Name | ATP-binding cassette, sub-family D (ALD), member 3 | ||
| Description | ATP-binding cassette, sub-family D (ALD), member 3 | ||
| Chromosome | 2q41 | ||
| Also Known As | 70-kDa peroxisomal membrane protein; Peroxisomal membrane protein 1 | ||
| Summary | may form an ATP binding channel; may play a role in active transport in peroxisomes [RGD] | ||
Orthologs and Paralogs
[
] Homologs - NCBI's HomoloGene Group: 2140
| ID | Symbol | Protein | Species |
|---|---|---|---|
| GeneID:5825 | ABCD3 | NP_002849.1 | Homo sapiens |
| GeneID:19299 | Abcd3 | NP_033017.2 | Mus musculus |
| GeneID:25270 | Abcd3 | NP_036936.1 | Rattus norvegicus |
| GeneID:32992 | CG12703 | NP_608354.1 | Drosophila melanogaster |
| GeneID:174126 | pmp-1 | NP_495407.1 | Caenorhabditis elegans |
| GeneID:174127 | pmp-2 | NP_495408.1 | Caenorhabditis elegans |
| GeneID:406803 | abcd3a | NP_998647.1 | Danio rerio |
| GeneID:424487 | ABCD3 | NP_001012615.1 | Gallus gallus |
| GeneID:457037 | ABCD3 | XP_513575.2 | Pan troglodytes |
| GeneID:479939 | ABCD3 | XP_537064.2 | Canis lupus familiaris |
| GeneID:526059 | ABCD3 | XP_604418.3 | Bos taurus |
| GeneID:830144 | PXA1 | NP_568072.1 | Arabidopsis thaliana |
| GeneID:1271802 | AgaP_AGAP000440 | XP_310656.2 | Anopheles gambiae |
| GeneID:4337574 | Os05g0107600 | NP_001054425.1 | Oryza sativa |
Antibodies
[
] Monoclonal and Polyclonal Antibodies
| No. | Provider | Product No. | Description |
|---|---|---|---|
| 1 | abcam | ab3421 | PMP70 antibody - Peroxisomal Membrane Marker (ab3421); Rabbit polyclonal to PMP70 - Peroxisomal Membrane Marker |
| 2 | abcam | ab28499 | PMP70 antibody (Biotin) (ab28499); Rabbit polyclonal to PMP70 - Peroxisomal Membrane Marker (Biotin) |
| 3 | sigma | P0497 | Anti-PMP70 antibody produced in rabbit ; |
| 4 | sigma | P0090 | Anti-PMP70−Atto 488 antibody produced in rabbit ; |
Gene Classification
[
] Gene Ontology
| ID | Category | GO Term |
|---|---|---|
| GO:0016021 | Component | integral to membrane |
| GO:0016020 | Component | membrane |
| GO:0005743 | Component | mitochondrial inner membrane |
| GO:0005739 | Component | mitochondrion |
| GO:0005778 | Component | peroxisomal membrane |
| GO:0005777 | Component | peroxisome |
| GO:0016887 | Function | ATPase activity |
| GO:0042626 | Function | ATPase activity, coupled to transmembrane movement of substances |
| GO:0005524 | Function | ATP binding |
| GO:0000166 | Function | nucleotide binding |
| GO:0005515 | Function | protein binding |
| GO:0043621 | Function | protein self-association |
| GO:0015910 | Process | peroxisomal long-chain fatty acid import |
| GO:0042221 | Process | response to chemical stimulus |
| GO:0042493 | Process | response to drug |
| GO:0006810 | Process | transport |
MicroRNA and Targets
[
] MicroRNA Sequences and Transcript Targets from miRBase at Sanger
| RNA Target | miRNA # | mat miRNA | Mature miRNA Sequence |
|---|---|---|---|
| ENSRNOT00000016739 | MI0003186 | hsa-miR-502-3p | AAUGCACCUGGGCAAGGAUUCA |
| ENSRNOT00000016739 | MI0004553 | mmu-miR-666-5p | AGCGGGCACAGCUGUGAGAGCC |
| ENSRNOT00000016739 | MI0004652 | mmu-miR-687 | CUAUCCUGGAAUGCAGCAAUGA |
| ENSRNOT00000016739 | MI0000616 | rno-miR-148b-3p | UCAGUGCAUCACAGAACUUUGU |
| ENSRNOT00000016739 | MI0003483 | rno-miR-224 | CAAGUCACUAGUGGUUCCGUUUA |
| ENSRNOT00000016739 | MI0000970 | rno-miR-299 | UGGUUUACCGUCCCACAUACAU |
| ENSRNOT00000016739 | MI0000639 | rno-miR-350 | UUCACAAAGCCCAUACACUUUCAC |
| ENSRNOT00000016739 | MI0006146 | rno-miR-425 | AAUGACACGAUCACUCCCGUUGA |
| ENSRNOT00000016739 | MI0006114 | rno-miR-466c | UGUGAUGUGUGCAUGUACAUG |
| ENSRNOT00000016739 | MI0003524 | rno-miR-540 | AGGUCAGAGGUCGAUCCUGG |
Selected Publications
[
] Gene-related publications indexed at PubMed
- [
] Di Benedetto R, et al. (2009) "PMP70 knock-down generates oxidative stress and pro-inflammatory cytokine production in C6 glial cells." Neurochem Int. 54(1):37-42. PMID:18992293 - [
] Di Benedetto R, et al. (2008) "RNAi-mediated silencing of ABCD3 gene expression in rat C6 glial cells: a model system to study PMP70 function." Neurochem Int. 52(6):1106-1113. PMID:18178290 - [
] Kwitek AE, et al. (2004) "High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence." Genome Res. 14(4):750-757. PMID:15060019 - [
] Kashiwayama Y, et al. (2002) "Nucleotide-induced conformational changes of PMP70, an ATP binding cassette transporter on rat liver peroxisomal membranes." Biochem Biophys Res Commun. 291(5):1245-1251. PMID:11883951 - [
] Tanaka AR, et al. (2002) "ATP binding/hydrolysis by and phosphorylation of peroxisomal ATP-binding cassette proteins PMP70 (ABCD3) and adrenoleukodystrophy protein (ABCD1)." J Biol Chem. 277(42):40142-40147. PMID:12176987 - [
] Wilcke M, et al. (2001) "Differential induction of peroxisomal populations in subcellular fractions of rat liver." Biochim Biophys Acta. 1544(1-2):358-369. PMID:11341945 - [
] Gouveia AM, et al. (1999) "Alkaline density gradient floatation of membranes: polypeptide composition of the mammalian peroxisomal membrane." Anal Biochem. 274(2):270-277. PMID:10527525 - [
] Albet S, et al. (1997) "Fenofibrate differently alters expression of genes encoding ATP-binding transporter proteins of the peroxisomal membrane." FEBS Lett. 405(3):394-397. PMID:9108325 - [
] Kamijo K, et al. (1990) "The 70-kDa peroxisomal membrane protein is a member of the Mdr (P-glycoprotein)-related ATP-binding protein superfamily." J Biol Chem. 265(8):4534-4540. PMID:1968461
By using RNA interference (RNAi) in rat C6 glial cells, we previously generated the cell line abcd3kd in which the peroxisomal half-transporter PMP70 was stably knocked-down. The observations that abcd3kd cells had peroxisomal beta-oxidation impairment and an increase of hexacosenoic acid in cholesterol ester fraction, indicated an overlapping function of PMP70 with adrenoleukodystrophy protein (ALDP), the peroxisomal half-transporters involved in X-linked adrenoleukodystrophy (X-ALD). The objective of the present study was to investigate whether PMP70 could affect some oxidative and inflammatory parameters, since many findings indicate oxidative damage in the brain of ALD patients and inflammation is a hallmark of the cerebral forms of X-ALD. We thus measured parameters indicative of oxidative stress, the expression or activity of antioxidant enzymes, and the production of some pro-inflammatory cytokines. Our results show that, due to inducible nitric oxide synthase up-regulation, abcd3kd cell line produces higher levels of nitrites than native C6 cells. The enhanced production of superoxide and thiobarbituric acid-reactive substances, the increased expression of mitochondrial superoxide dismutase, and the reduction of catalase and glutathione peroxidase activities confirm the presence of an oxidative process. We then measured the concentrations of TNFalpha, IFNgamma, and IL-12 and we observed that abcd3kd cells produce higher amounts of pro-inflammatory cytokines compared to native C6 cells. By using neutralizing antibodies against IL-12, not only inflammatory parameters significantly decrease, but nitrite and superoxide production is also affected. This demonstrates that oxidative status of abcd3kd cells is not a direct PMP70 knock-down consequence, but depends on IL-12 release. The scenery induced by the knock-down of PMP70 in C6 cells recall the oxidative and inflammatory status observed in human X-ALD and thus reinforce the idea that PMP70 could affect the clinical course of the disease.
The function of PMP70, one of the four ABC half-transporters of mammalian peroxisomes, encoded by ABCD3 gene, is still unclear. The finding that PMP70 over-expression partially corrected very long-chain fatty acid oxidation defects in fibroblasts of X-linked adrenoleukodystrophy patients, has unveiled its potential clinical relevance, prompting us to set up a model system to study PMP70 function. We used the RNA interference technique, a powerful approach to loss-of-function gene expression analysis, to knockdown the ABCD3 gene in the rat glial C6 cell line, since glia could represent the target tissue of X-linked adrenoleukodystrophy disease. Cells were transfected with a vector for RNA interference generating small interfering RNAs that specifically target the ABCD3 mRNA. By using a puromycin-selectable version of the plasmid, we generated a stable cell line (abcd3kd), in which we observed a stable decrease of PMP70 protein expression greater than 70%. We thus examined the effect of ABCD3 knockdown on lignoceric and palmitic acids beta-oxidation and we found that in abcd3kd cells the rate of peroxisomal and mitochondrial beta-oxidation activities were both reduced about one-third compared with control cells. The mitochondrial membrane potential, determined by cytofluorometric analysis, was also affected. Lipid and fatty acid analyses of abcd3kd cells showed an increase of hexacosenoic acid (C26:0) in the cholesteryl-ester fraction. These results add another clue about the overlapping function of PMP70 and ALDP, the peroxisomal protein involved in X-linked adrenoleukodystrophy, since C26:0 is the biochemical marker of the disease and in the brain lesions it is accumulated in the cholesteryl-ester fraction. Considered as a whole, our results indicate that the abcd3kd cell line is a valuable tool to further study the function of PMP70 and eventually its role in X-linked adrenoleukodystrophy.
The laboratory rat is a major model organism for systems biology. To complement the cornucopia of physiological and pharmacological data generated in the rat, a large genomic toolset has been developed, culminating in the release of the rat draft genome sequence. The rat draft sequence used a variety of assembly packages, as well as data from the Radiation Hybrid (RH) map of the rat as part of their validation. As part of the Rat Genome Project, we have been building a high-density RH map to facilitate data integration from multiple maps and now to help validate the genome assembly. By incorporating vectors from our lab and several other labs, we have doubled the number of simple sequence length polymorphisms (SSLPs), genes, expressed sequence tags (ESTs), and sequence-tagged sites (STSs) compared to any other genome-wide rat map, a total of 24,437 elements. During the process, we also identified a novel approach for integrating the RH placement results from multiple maps. This new integrated RH map contains approximately 10 RH-mapped elements per Mb on the genome assembly, enabling the RH maps to serve as a scaffold for a variety of data visualization tools.
Nucleotide-induced conformational changes of the 70-kDa peroxisomal membrane protein (PMP70) were investigated by means of limited-trypsin digestion. Rat liver peroxisomes preincubated with various nucleotides were subsequently digested by trypsin. The digestion products were subjected to immunoblot analysis with an anti-PMP70 antibody that recognizes the carboxyl-terminal 15 amino acids of the protein. PMP70 was initially cleaved in the boundary region between the transmembrane and nucleotide-binding domains and a carboxyl-terminal 30-kDa fragment resulted. The fragment in turn was progressively digested at the helical domain between the Walker A and B motifs. The fragment, however, could be stabilized with MgATP or MgADP. In contrast to MgATP, MgATP-gammaS protected whole PMP70 as well as the fragment. The 30-kDa fragment processed by trypsin was recovered in the post-peroxisomal fraction as a complex with a molecular mass of about 60 kDa irrespective of the presence of MgATP. These results suggest that PMP70 exists as a dimer on the peroxisomal membranes and the binding and hydrolysis of ATP induce conformational changes in PMP70 close to the boundary between the transmembrane and nucleotide binding domains and the helical domain between the Walker A and B motifs.
The 70-kDa peroxisomal membrane protein (PMP70) and adrenoleukodystrophy protein (ALDP), half-size ATP-binding cassette transporters, are involved in metabolic transport of long and very long chain fatty acids into peroxisomes. We examined the interaction of peroxisomal ATP-binding cassette transporters with ATP using rat liver peroxisomes. PMP70 was photoaffinity-labeled at similar efficiencies with 8-azido-[alpha-32P]ATP and 8-azido-[gamma-32P]ATP when peroxisomes were incubated with these nucleotides at 37 degrees C in the absence Mg2+ and exposed to UV light without removing unbound nucleotides. The photoaffinity-labeled PMP70 and ALDP were co-immunoprecipitated together with other peroxisomal proteins, which also showed tight ATP binding properties. Addition of Mg2+ reduced the photoaffinity labeling of PMP70 with 8-azido-[gamma-32P]ATP by 70%, whereas it reduced photoaffinity labeling with 8-azido-[alpha-32P]ATP by only 20%. However, two-thirds of nucleotide (probably ADP) was dissociated during removal of unbound nucleotides. These results suggest that ATP binds to PMP70 tightly in the absence of Mg2+, the bound ATP is hydrolyzed to ADP in the presence of Mg2+, and the produced ADP is dissociated from PMP70, which allows ATP hydrolysis turnover. Properties of photoaffinity labeling of ALDP were essentially similar to those of PMP70. Vanadate-induced nucleotide trapping in PMP70 and ALDP was not observed. PMP70 and ALDP were also phosphorylated at a tyrosine residue(s). ATP binding/hydrolysis by and phosphorylation of PMP70 and ALDP are involved in the regulation of fatty acid transport into peroxisomes.
In rat liver, peroxisome proliferators induce profound changes in the number and protein composition of peroxisomes, which upon subcellular fractionation is reflected in heterogeneity in sedimentation properties of peroxisome populations. In this study we have investigated the time course of induction of the peroxisomal proteins catalase, acyl-CoA oxidase (ACO) and the 70 kDa peroxisomal membrane protein (PMP70) in different subcellular fractions. Rats were fed a di(2-ethylhexyl)phthalate (DEHP) containing diet for 8 days and livers were removed at different time-points, fractionated by differential centrifugation into nuclear, heavy and light mitochondrial, microsomal and soluble fractions, and organelle marker enzymes were measured. Catalase was enriched mainly in the light mitochondrial and soluble fractions, while ACO was enriched in the nuclear fraction (about 30%) and in the soluble fraction. PMP70 was found in all fractions except the soluble fraction. DEHP treatment induced ACO, catalase and PMP70 activity and immunoreactive protein, but the time course and extent of induction was markedly different in the various subcellular fractions. All three proteins were induced more rapidly in the nuclear fraction than in the light mitochondrial or microsomal fractions, with catalase and PMP70 being maximally induced in the nuclear fraction already at 2 days of treatment. Refeeding a normal diet quickly normalized most parameters. These results suggest that induction of a heavy peroxisomal compartment is an early event and that induction of 'small peroxisomes', containing PMP70 and ACO, is a late event. These data are compatible with a model where peroxisomes initially proliferate by growth of a heavy, possibly reticular-like, structure rather than formation of peroxisomes by division of pre-existing organelles into small peroxisomes that subsequently grow. The various peroxisome populations that can be separated by subcellular fractionation may represent peroxisomes at different stages of biogenesis.
A method for purification of the peroxisomal membrane from rat liver is described. The procedure consists of floating the (contaminated) peroxisomal membranes through an alkaline sucrose density gradient. A good resolution between the peroxisomal membrane and other membrane systems is achieved. Using these floated peroxisomal membranes we have determined that only 7.8 +/- 0.9% of the total peroxisomal protein is alkali resistant. The polypeptide composition of these highly pure peroxisomal membranes was analyzed by SDS-PAGE. Bands corresponding to polypeptides with apparent molecular masses of 15, 18, 22, 24, 26, 29, 35, 36, 38, 40, 52, 55, 70, 74-77, and 88 kDa are detected upon Coomassie blue staining of polyacrylamide gels. The identity of several of these polypeptides was determined by N-terminal sequencing and Western blotting analysis.
The 70-kDa peroxisomal membrane protein (PMP 70), adrenoleukodystrophy protein (ALDP) and adrenoleukodystrophy-related protein (ALDRP) belong to the ATP-binding transporter family, share a structure of half-transporters and are localized in the peroxisomal membrane of mammals. It was suggested that these proteins may heterodimerize to form functional transporters. The expression of the three genes was examined in various tissues of control or fenofibrate (a peroxisome proliferator)-treated rats using Northern and immuno-blotting techniques. The patterns of tissue expression were distinct for the three genes. Upon treatment, expression of the ALD gene was not altered while that of the PMP 70 and ALDR genes was strongly increased in intestine and liver, respectively. The absence of coordinated expression excludes that the three transporters function as exclusive and obligatory partners. We also report for the first time that the ALDR gene is inducible in rodents and that the corresponding mRNA is different in length in rat (3.0 and 5.5 kb) and in mouse and human (4.2 kb).
The 70-kDa peroxisomal membrane protein (PMP70) is one of the major integral membrane proteins of rat liver peroxisomes. cDNA clones for PMP70 were isolated and sequenced. The predicted amino acid sequence (659 amino acid residues) revealed that the carboxyl-terminal region of PMP70 has strong sequence similarities to a group of ATP-binding proteins such as MalK and Mdr. These proteins form a superfamily and are involved in various biological processes including membrane transport. Limited protease treatment of peroxisomes showed that the ATP-binding domain of PMP70 is exposed to the cytosol. The hydropathy profile, in comparison with those of several other members of the ATP-binding protein superfamily, suggests that PMP70 is a transmembrane protein possibly forming a channel. Based on these results, we propose that PMP70 is involved in active transport across the peroxisomal membrane.